View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18171_low_3 (Length: 212)
Name: NF18171_low_3
Description: NF18171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18171_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 81 - 212
Target Start/End: Original strand, 26881557 - 26881686
Alignment:
| Q |
81 |
aagtaactgggttattgttaaatctagaaaacttttttacacatgcatccaatcacgttacac-attgtgccaaattgttatgttattagctcgtaaaat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
26881557 |
aagtaactgggttattgttaaatctagaaaacttttttacacatgcatccaatcacgttacacgattgtgccaatttgttatg---ttagcttgtaaaat |
26881653 |
T |
 |
| Q |
180 |
atctcaaaaaatatatacatgacatgatttgat |
212 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |
|
|
| T |
26881654 |
atctcaaaaaatatatatatgacgtgatttgat |
26881686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University