View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18172_high_2 (Length: 382)
Name: NF18172_high_2
Description: NF18172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18172_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 39540303 - 39540208
Alignment:
| Q |
1 |
ttaggatatattttggaaaatgcttaatgtcacaaaacattatttcttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540303 |
ttaggatatattttggaaaatgcttaatgtcgcaaaacattatttcttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
39540208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 303
Target Start/End: Original strand, 437632 - 437718
Alignment:
| Q |
217 |
gtttgtgccgagtcggagcgcgccgagtctctgagtttgattcggtttaaggatgatatgtattttccttcctactaaattgcattg |
303 |
Q |
| |
|
||||||| ||||||||| || || ||||||| |||||| | |||||| |||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
437632 |
gtttgtgtcgagtcggaacgtgctgagtctccgagtttcactcggttcaaggatgagatctattttccttcctcctaaattgcattg |
437718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University