View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18173_high_42 (Length: 278)

Name: NF18173_high_42
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18173_high_42
NF18173_high_42
[»] chr4 (1 HSPs)
chr4 (217-263)||(53302778-53302824)
[»] chr2 (3 HSPs)
chr2 (217-263)||(30269369-30269415)
chr2 (217-263)||(31331878-31331924)
chr2 (217-263)||(31338607-31338653)
[»] chr6 (1 HSPs)
chr6 (218-265)||(30825201-30825248)
[»] chr8 (2 HSPs)
chr8 (217-263)||(25641257-25641303)
chr8 (122-180)||(34863703-34863761)
[»] chr3 (1 HSPs)
chr3 (217-263)||(7403857-7403903)
[»] chr5 (3 HSPs)
chr5 (217-263)||(5075906-5075952)
chr5 (217-263)||(7413271-7413317)
chr5 (217-263)||(37190658-37190704)


Alignment Details
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 53302824 - 53302778
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  53302824 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 53302778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 30269415 - 30269369
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  30269415 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 30269369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 263
Target Start/End: Original strand, 31331878 - 31331924
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
T  31331878 gatgaagtgtgagttttgtattgtgttggtttttgttttgattttgc 31331924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 263
Target Start/End: Original strand, 31338607 - 31338653
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
T  31338607 gatgaagtgtgagttttgtattgtgttggtttttgttttgattttgc 31338653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 265
Target Start/End: Complemental strand, 30825248 - 30825201
Alignment:
Q  218 atgaagtgtgagttttgtattgtgttggttattgttttgattttgcct 265  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||    
T  30825248 atgaagtgtgagttttgtattgtgttggttattattttgattttgcct 30825201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 25641303 - 25641257
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
T  25641303 gatgaagtgtgagttttgtattgtgttggtttttgttttgattttgc 25641257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 34863761 - 34863703
Alignment:
Q  122 taatcgtgttctgcttcttcaatttccatagatctgttctatgcgcaaccacaagcttc 180  Q
    |||||| |||||||||||||||||||||| ||||||||||||  | ||||||| |||||    
T  34863761 taatcgcgttctgcttcttcaatttccatggatctgttctatttgtaaccacatgcttc 34863703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 263
Target Start/End: Original strand, 7403857 - 7403903
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
T  7403857 gatgaagtgtgagttttgtattgtgttggtttttgttttgattttgc 7403903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 263
Target Start/End: Original strand, 5075906 - 5075952
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||    
T  5075906 gatgaagtgtgagttttgtgttgtgttggttattgttttcattttgc 5075952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 7413317 - 7413271
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||    
T  7413317 gatgaagtgtgagttttgtgttgtgttggttattgttttcattttgc 7413271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 37190704 - 37190658
Alignment:
Q  217 gatgaagtgtgagttttgtattgtgttggttattgttttgattttgc 263  Q
    ||||||||||||||||||| ||| ||||||| ||||||| |||||||    
T  37190704 gatgaagtgtgagttttgtgttgcgttggttcttgttttcattttgc 37190658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University