View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_high_44 (Length: 262)
Name: NF18173_high_44
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 27327729 - 27327491
Alignment:
| Q |
1 |
tgagtagtctagggtcatgcgagcatttaatgcattgcatcaatcaagggagcggttaaagttgttcgatgagacg-ttgtttgctttaggtgatgtggt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
27327729 |
tgagtagtctagggtcatgcgagcatttaatgtattgcatcaatcaagggagcggttaaagttgtttgatgagacggttgtttgctttaggtgatgtggt |
27327630 |
T |
|
| Q |
100 |
gccttgctaggggtctgataaggaacgttggattaaacctttgaatctcatgctcatctcaacgattggtttcgaatcatttcttttctgccatccattg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27327629 |
gccttgctaggggtctgataaggaacgttggattaaacctttgaatctgatgctcatctcaacaattggtttcgaatcatttcttttctgccatccattg |
27327530 |
T |
|
| Q |
200 |
cattcgaacacgcatgaaagggaaagtgagtgattcacg |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27327529 |
cattcgaacacctatgaaagggaaagtgagtgattcacg |
27327491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University