View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_high_58 (Length: 245)
Name: NF18173_high_58
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_high_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 25999198 - 25999133
Alignment:
| Q |
137 |
cgttccaaaatatgaattaaatttgattttaaagctgagtgcaatgttcacaatctgaaaagcttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25999198 |
cgttccaaaatatgaattaaatttgattttaaagctgagtgcaatgttcacaatctgaaaaacttt |
25999133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 25997169 - 25997068
Alignment:
| Q |
143 |
aaaatatgaattaaatttgattttaaagctgagtg--caatgttcacaatctgaaaagcttttcaagcaagtggatgacatgaaaaatatgattagagtt |
240 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||| |||| ||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
25997169 |
aaaatatgaaggaaatatggttttaaagctgagtgtgcaatattcacaaactgaaaagcttttcaagcaagtggataacatg-aaaatctgattagagtt |
25997071 |
T |
|
| Q |
241 |
tct |
243 |
Q |
| |
|
||| |
|
|
| T |
25997070 |
tct |
25997068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University