View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_high_80 (Length: 214)
Name: NF18173_high_80
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_high_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 32528338 - 32528141
Alignment:
| Q |
1 |
tgtccattgttatttcagaactctggcggttacgtcagtggttttggnnnnnnnnnccccatctaggtaggttcagtttgaaatctttagtttgtggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32528338 |
tgtccattgttatttcagaactctggcggttacgtcagtggttttggaagaaaaa-ccccatctaggtaggttcagtttgaaatctttagtttgtggctg |
32528240 |
T |
|
| Q |
101 |
tatttcttgcctctgatttctggttctttccaaatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgtctgttaatatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528239 |
tatttcttgcctctgatttctggttctttccagatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgtctgttaatatt |
32528141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University