View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_54 (Length: 251)
Name: NF18173_low_54
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_54 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 251
Target Start/End: Original strand, 24591134 - 24591373
Alignment:
| Q |
12 |
atgaatgacacaaaaagaggaaaattgaaaagtgggtccaatacttcttgaattggtcccatatttgctatatccaatcaagtaattgtttttgaatgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24591134 |
atgaatgacacaaaaagaggaaaattgaaaagtgggtccaatacttcttgaattggtcccatatttgctatatccaatcaagtaattgtttttgaatgaa |
24591233 |
T |
|
| Q |
112 |
atttttaatgtagcaatcggtcggtgtgactttctggcttttggttggcaagttaggccacatgctacttttggaatttttgtgaagggaccatatgata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24591234 |
atttttaatgtagcaatcggtcggtgtgactttctggcttttggttggcaagttaggccacatgctacttttggaatttttgtgaagggaccatatgata |
24591333 |
T |
|
| Q |
212 |
tagtgttgttataatcaaggaaatcataggatttacaact |
251 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24591334 |
tagtgttgttataagcaaggaaatcataggatttacaact |
24591373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University