View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_55 (Length: 251)
Name: NF18173_low_55
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 154
Target Start/End: Original strand, 30769190 - 30769324
Alignment:
| Q |
20 |
gctttggttgttgtttcttgtctttggctcattcctttcatatgcagctgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769190 |
gctttggttgttgtttcttgtctttggctcattcctttcatatgcagctgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaa |
30769289 |
T |
 |
| Q |
120 |
aacctgccattgcaatctttcagattccttttatc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769290 |
aacctgccattgcaatctttcagattccttttatc |
30769324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University