View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18173_low_55 (Length: 251)

Name: NF18173_low_55
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18173_low_55
NF18173_low_55
[»] chr4 (1 HSPs)
chr4 (20-154)||(30769190-30769324)


Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 154
Target Start/End: Original strand, 30769190 - 30769324
Alignment:
20 gctttggttgttgtttcttgtctttggctcattcctttcatatgcagctgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30769190 gctttggttgttgtttcttgtctttggctcattcctttcatatgcagctgttgaattgtgacaattccatcactactgtttgctggtcccaaaaagccaa 30769289  T
120 aacctgccattgcaatctttcagattccttttatc 154  Q
    |||||||||||||||||||||||||||||||||||    
30769290 aacctgccattgcaatctttcagattccttttatc 30769324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University