View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18173_low_63 (Length: 245)

Name: NF18173_low_63
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18173_low_63
NF18173_low_63
[»] chr7 (2 HSPs)
chr7 (137-202)||(25999133-25999198)
chr7 (143-243)||(25997068-25997169)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 25999198 - 25999133
Alignment:
137 cgttccaaaatatgaattaaatttgattttaaagctgagtgcaatgttcacaatctgaaaagcttt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25999198 cgttccaaaatatgaattaaatttgattttaaagctgagtgcaatgttcacaatctgaaaaacttt 25999133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 25997169 - 25997068
Alignment:
143 aaaatatgaattaaatttgattttaaagctgagtg--caatgttcacaatctgaaaagcttttcaagcaagtggatgacatgaaaaatatgattagagtt 240  Q
    ||||||||||  |||| || |||||||||||||||  |||| ||||||| |||||||||||||||||||||||||| ||||| ||||| |||||||||||    
25997169 aaaatatgaaggaaatatggttttaaagctgagtgtgcaatattcacaaactgaaaagcttttcaagcaagtggataacatg-aaaatctgattagagtt 25997071  T
241 tct 243  Q
    |||    
25997070 tct 25997068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University