View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_67 (Length: 237)
Name: NF18173_low_67
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_67 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 47736126 - 47736346
Alignment:
| Q |
17 |
agttaactcatccactatttaaagattgattgcacacttaaaaacactcacacttttgctatcacagtgtgcctattcatatttccgtaggagcattaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47736126 |
agttaactcatccactatttaaagattgattgcacacttaaaaacactcacacttttgctatcacattgtgcctattcatatttccgtaggagcattaaa |
47736225 |
T |
 |
| Q |
117 |
tgtgagcaaataaagagattgttgttacataaaattgtgtataaatatttcttatgttttgaattctgcctaatcaattaccatggttcagtgctcatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47736226 |
tgtgagcaaataaagagattgttgttacataaaattgtgtataaatgtttcctatgttttgaattctgcgtaatcaattaccatggttcagtgctcatta |
47736325 |
T |
 |
| Q |
217 |
ataagtttagtttaatatgat |
237 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
47736326 |
ataagtttagtttgatatgat |
47736346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University