View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_75 (Length: 229)
Name: NF18173_low_75
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 43850755 - 43850542
Alignment:
| Q |
1 |
tagagtcacgtgctggaattaaccgatgtttccaatcaacctaatgatgtccaaagtttagataattagctttacttttgatttcttagagttgggaatc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43850755 |
tagagtcacctgctggaattaaccgatgtttccaatcaacctaatgatgtccaaagtttagataattagctttacttttgatttcttagagttgggaatc |
43850656 |
T |
 |
| Q |
101 |
caacaaccatgattctaaataaaagtctctaagtggaactgaatgtttgttaagtccaacatcaattcttgacaccaaagctttaacctcatt---gaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43850655 |
caacaaccatgattctaaataaaagtctctaagtggaactgaaggtttgataagtccaacatcaattcttgacaccaaagctttaacctcattggagaat |
43850556 |
T |
 |
| Q |
198 |
ccattctcaattac |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43850555 |
ccattctcaattac |
43850542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 193
Target Start/End: Original strand, 31875780 - 31875852
Alignment:
| Q |
121 |
aaaagtctctaagtggaactgaatgtttgttaagtccaacatcaattcttgacaccaaagctttaacctcatt |
193 |
Q |
| |
|
|||| ||||| | |||||||||| |||| ||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
31875780 |
aaaaatctctcactggaactgaagctttgataagtccaacatcaactcttgacacaaaagcattaacctcatt |
31875852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University