View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_77 (Length: 227)
Name: NF18173_low_77
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_77 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 76 - 227
Target Start/End: Original strand, 28399001 - 28399152
Alignment:
| Q |
76 |
ttggccaaattaatcactagaagactttttataagttgccaatactaaccactaaaacttttagatatatgtatatcgtaggataagattactctcataa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28399001 |
ttggccaaattaatcactagaagactttttataagttgccaatactaaccactaaaacttttagatatatgtatatcgtaggataagattactctcataa |
28399100 |
T |
 |
| Q |
176 |
accttgatgtattcatatttatgagtaacttgttatactattatattcatta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28399101 |
accttgatgtattcatatttatgagtaacttgttatactattatattcatta |
28399152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 88
Target Start/End: Original strand, 28398868 - 28398949
Alignment:
| Q |
7 |
attttatttctaaaacaaacaaaatccacatgaaatcaaatataaatgaatatttgataccatggtggattggccaaattaa |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398868 |
attttatttctagaacaaacaaaatccacatgaaatcaaatataaatgaatatttgataccatggtggattggccaaattaa |
28398949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University