View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_79 (Length: 226)
Name: NF18173_low_79
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_79 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 47736352 - 47736577
Alignment:
| Q |
1 |
cagacttagtttaaagcagtcatcacatacagtcatgtccctttcttcatgaattcatagaacataggaaacttttatttaaatcaccaagttgaaccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47736352 |
cagacttagtttaaagcagtcatcacatacagtcatgtccctttcttcatgaattcatagaacataggaaacttttatttaaatcaccaagttgaaccag |
47736451 |
T |
 |
| Q |
101 |
accaagcatgtcatcaagtatgaagcgtaaagttcttgaaggcaaccgagcatcgactaatataagcaatggtaagcatccggcgtgctaatcttttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
47736452 |
accaagcatgtcatcaagtatgaagcgtaaagttcttgaaggcatccgagcatcgactgatataagcaatggtaagcatctggcgtgctaaccttttttg |
47736551 |
T |
 |
| Q |
201 |
tcactcttttattgtagttatgatga |
226 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
47736552 |
tcactcttttattgtagttacgatga |
47736577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University