View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18173_low_87 (Length: 209)

Name: NF18173_low_87
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18173_low_87
NF18173_low_87
[»] chr7 (1 HSPs)
chr7 (11-191)||(33398475-33398657)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 11 - 191
Target Start/End: Complemental strand, 33398657 - 33398475
Alignment:
11 agcagagaatgaaaaattaaatactaataatgcataactaaaagtttctcttcttttcaatgtatttgtgaaaaagataatataaaccaaattgcaaagt 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33398657 agcaaagaatgaaaaattaaatactaataatgcataactaaaagtttctcttcttttcaatgtatttgtgaaaaagataatataaaccaaattgcaaagt 33398558  T
111 cagaaa--atattttatgtctgtatcaagtgcaatgatattgtttatgaatgttctatgcattcggagcaagcatggattgat 191  Q
    ||||||  ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33398557 cagaaaatatattttatgtctatatcaagtgcaatgatattgtttatgaatgttctatgcattcggagcaagcatggattgat 33398475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University