View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_88 (Length: 205)
Name: NF18173_low_88
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_88 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 25397646 - 25397468
Alignment:
| Q |
12 |
atgaagaagatgatccattttaaatagagcgctatagtatagtgtggatgtggatgctctctaatgtgaacaagcattaatggaccaatgactttggaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25397646 |
atgaagaagatgatccattttaaatagagcgctatagtatagtgtggatgtggatgctctctaatgtgaacaagcattaatggaccaatgactttggaaa |
25397547 |
T |
|
| Q |
112 |
ggagtggatggcaggctccgtatgatatgcttttgcacgtattatcatgttccnnnnnnnagaggtatccgtatgtatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25397546 |
ggagtggatggcaggctccgtatgatatgcttttgcacgtattatcatgttcctttttttagaggtatccgtatgtatt |
25397468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University