View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18173_low_90 (Length: 201)
Name: NF18173_low_90
Description: NF18173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18173_low_90 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 35178359 - 35178523
Alignment:
| Q |
22 |
tttgacctcacaaacacctatctccacctccttatcatttcctccttcgttgaagaactctcccacttccatctccaaccacccatctgctctctccttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35178359 |
tttgacctcacaaacacctatctccacctccttatcatttcctccttcattgaagaactctcccaattccatctccaaccacccatctgctctctccttc |
35178458 |
T |
 |
| Q |
122 |
ggatgcttctgcatatcatctacactttctattggttctactagtggtcgaagtcgagtgaatat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178459 |
ggatgcttctgcatatcatctacactttctattggttctactagtggtcgaagtcgagtgaatat |
35178523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 22 - 151
Target Start/End: Original strand, 35182316 - 35182445
Alignment:
| Q |
22 |
tttgacctcacaaacacctatctccacctccttatcatttcctccttcgttgaagaactctcccacttccatctccaaccacccatctgctctctccttc |
121 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| ||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35182316 |
tttgacctcacaaacacctatgtccacctgcttatcatctcctccttcattgaagaactctcccagttccatctccaaccatccatctgctctctccttt |
35182415 |
T |
 |
| Q |
122 |
ggatgcttctgcatatcatctacactttct |
151 |
Q |
| |
|
|||| |||| ||| ||| ||||||||||| |
|
|
| T |
35182416 |
ggatacttccgcagatcggctacactttct |
35182445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University