View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18174_high_5 (Length: 281)
Name: NF18174_high_5
Description: NF18174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18174_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 72 - 271
Target Start/End: Complemental strand, 42950433 - 42950233
Alignment:
| Q |
72 |
aaatatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaaga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950433 |
aaatatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaaga |
42950334 |
T |
 |
| Q |
172 |
taacagtgttcgaatgctaggaaaagggaagataacggtgttatgtttcacatgcc-actaccttcatcttcttcaacagtatcaaacaaaatatccttt |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950333 |
taacagtgttcgaatgctaggaaaatggaagataacggtgttatgtttcacatgccttataccttcatcttcttcaacagtatcaaacaaaatatccttt |
42950234 |
T |
 |
| Q |
271 |
g |
271 |
Q |
| |
|
| |
|
|
| T |
42950233 |
g |
42950233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 214 - 264
Target Start/End: Complemental strand, 2852033 - 2851983
Alignment:
| Q |
214 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2852033 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2851983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 214 - 264
Target Start/End: Complemental strand, 2904065 - 2904015
Alignment:
| Q |
214 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2904065 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2904015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University