View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18174_low_9 (Length: 234)
Name: NF18174_low_9
Description: NF18174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18174_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 14362886 - 14362675
Alignment:
| Q |
1 |
aatctggctccatctataagacttaacctagttggtatctttactttttcttatgattggtgataaaagttcaaaattatagttggaccagttattgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||| ||| |
|
|
| T |
14362886 |
aatctggctccatctataagacttaacctagttcgtatctttactttttcttatgattggtgataaaagttcaaaattatagttcgactatttattatta |
14362787 |
T |
 |
| Q |
101 |
taagagaattactacgatacaaaaacctataacaataactagtcaactattgatccaaaaatcatcaaaactaaacaaacaatcataaatagcaattgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14362786 |
taagagaattactacgatacaaaaacctataacaataactagtcaactattgatccaaaaatcatcaaaactaaacaaacaatcataaatagcaattgca |
14362687 |
T |
 |
| Q |
201 |
aaggaaatggag |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14362686 |
aaggaaatggag |
14362675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University