View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18176_high_22 (Length: 267)
Name: NF18176_high_22
Description: NF18176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18176_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 37 - 253
Target Start/End: Complemental strand, 7958811 - 7958597
Alignment:
| Q |
37 |
tatgatataaaatgctcggttctaaaaatggctgaattgacaatttgtgtaatattatctacactccataatttcataccacatgatatatgatttgatg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958811 |
tatgatataaaatgctcggttctaaaaatggctgaattgacaatttgtgtaatattatctacactccataatttcataccacatgatatatgatttgatg |
7958712 |
T |
 |
| Q |
137 |
ctcaaatttaatgcatattttattgcacatgatggtccaattcctaacccctaattagattaatcttgtcttgggatccatatatccctattttcttaag |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7958711 |
ctcaaatttaatgcatattttattgcacatgatggtccaattcctaacccctaattagattaatcttgtcttgggatcc--atatccctattttcttaag |
7958614 |
T |
 |
| Q |
237 |
cacatgatcagctaaga |
253 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7958613 |
cacatgatcagctaaga |
7958597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University