View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18176_low_18 (Length: 358)
Name: NF18176_low_18
Description: NF18176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18176_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 182 - 347
Target Start/End: Complemental strand, 37532125 - 37531960
Alignment:
| Q |
182 |
caatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcagg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532125 |
caatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcagg |
37532026 |
T |
|
| Q |
282 |
tgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgatgatgt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37532025 |
tgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgattatgt |
37531960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 37532370 - 37532200
Alignment:
| Q |
18 |
caaatatcgttgttgtgagttaaccattgatattgaagagaccacatatagttgtgaataacata----tatataaatgagtgtacgtaatacaaatata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37532370 |
caaatatcgttgttgtgagttaaccattgatattgaagagaccacatatagttgtgaataacatacatatatataaatgagtgtacgtaatacaaatata |
37532271 |
T |
|
| Q |
114 |
atttgtttcaagtttttatatttattcttgagaatatatttcagatagtcgcaaattctcacctagtgcaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532270 |
atttgtttcaagtttttatatttattcttgagaatatatttcagatagtcgcaaattctcacctagtgcaa |
37532200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University