View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_high_13 (Length: 381)
Name: NF18177_high_13
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 17 - 333
Target Start/End: Complemental strand, 10906303 - 10905987
Alignment:
| Q |
17 |
agttgtaactgttattaatttagctagtaaactgcagaatcaatgtatatatgacaattttactgaacagagaatcagtctcaccggcttgtattaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10906303 |
agttgtaactgttattaatttagctagtaaactgcagaatcaatgtatatatgacaattttactgaacagagaatcagtctcaccggcttgtattaaatt |
10906204 |
T |
|
| Q |
117 |
gtatttatatgggaaaaatgtctttagaaggataacacagtttcattcataagcttttaggagtttgacaaattcaacaagaacatcaattgaatatgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10906203 |
gtatttatatgggaaaaatgtctttagaaggataacacagtttcattcataagcttttaggagtttgacaaattcaacaagaacatcaattgaatatgtg |
10906104 |
T |
|
| Q |
217 |
atcgtatcatatatgaactcaccactcttgctatttaaacagcaagggttattttccgatggagattagtcatcattaaacggtgatggaaactccgtac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10906103 |
atcgtatcatatatgaactcaccactcttgctatttatacagcaagggttattttccgacggagattagtcatcattaaacggtgatggaaactccgtac |
10906004 |
T |
|
| Q |
317 |
ctataacatggtaatcc |
333 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10906003 |
ctataacatggtaatcc |
10905987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University