View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_high_24 (Length: 264)
Name: NF18177_high_24
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 48593917 - 48593674
Alignment:
| Q |
18 |
cactatatattcaatatttagtcataaaattgtaggattagtttagttatctcaatatctaatatcacataatataactccgtacctccgttgacattta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48593917 |
cactatatattcaatatttagtcataaaattgtaggattagtttagttatctcaatatctagtatcacataatataactccgtacctccgttgacattta |
48593818 |
T |
 |
| Q |
118 |
tagagacccttatacttgg------tattctttcaagaaagctataatttcttgttcttataccttgttattacattaataaagtaaggaatttccttat |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48593817 |
tagagacccttatacttggtttgcatattctttcaagaaacctataatttcttgttcttataccttgttattacattaataaagtaaggaatttccttat |
48593718 |
T |
 |
| Q |
212 |
atttactgtttatgcctttagtttatcttgttttgttgatgatg |
255 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48593717 |
atttacggtttatgcctttagtttatcttgttttgtttatgatg |
48593674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University