View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_high_26 (Length: 255)
Name: NF18177_high_26
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 4947221 - 4946986
Alignment:
| Q |
1 |
tttctcgactttaggttttacatctgaataatcaaggttataaaattgctttgaagcaattggtgttgaactggagtgctcaaaagaaatgagttgaggt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4947221 |
tttcccgactttaggttttacatctgaataatcaaggttataaaattgctttgaagcaattggtgttgaactggagtgctcaaaagaaatgagttgaggt |
4947122 |
T |
 |
| Q |
101 |
gatgactgggaagaaggggttctcgatgtcttgatcttcttggttggccttgtttgatcatcaggatgagtttcaactgggaaacaatttggtgtggttt |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4947121 |
gatgactgggaagaaggggttatcgatgtcttgatcttcttggttggccttgtttgatcatcaggatgagtttcaactgggaaacaatttggtgtcgttt |
4947022 |
T |
 |
| Q |
201 |
cgttgtcatcaaagtgaaagccaaagttgtcgaata |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4947021 |
cgttgtcatcaaagtgaaagccaaagttgtcgaata |
4946986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University