View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_high_28 (Length: 252)
Name: NF18177_high_28
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 33375894 - 33375672
Alignment:
| Q |
20 |
gtgtcaacaaataggaatgcaacaaaagaaatttaggttaaagctatagacaaaatctcctgcttactttattaattcaactaagtattttattaccaat |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
33375894 |
gtgtcaacaaataagaatgcaacaaaagaaatttaggttaaagctatagacaaaatctccagcttactttattaattcaaccaagtattttattatcaat |
33375795 |
T |
 |
| Q |
120 |
attgaatttggttatctctaactactacaaatttgctttatcttcccttgtgccttttatttgttcaccacctttaattttgacaacaatggtttcttcc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33375794 |
attgaatttggttatctctaactactacaaatttgctttatcttcccttgtgcctttcatttgttcaccacctttaattttgacaacaatggtttcttcc |
33375695 |
T |
 |
| Q |
220 |
ttttttcatacactcatattctt |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33375694 |
ttttttcatacactcatattctt |
33375672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 33384233 - 33384153
Alignment:
| Q |
20 |
gtgtcaacaaataggaatgcaacaaaagaaatttaggttaaagctatagacaaaatctcctgcttactttattaattcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33384233 |
gtgtcaacaaataggaatgcaacaaaagaaatttaggttaaagctatagacaaaatttccagcttactttattaattcaac |
33384153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 219
Target Start/End: Complemental strand, 33384140 - 33384072
Alignment:
| Q |
146 |
acaaatttgctttatcttcccttgtgccttttatttgttcaccacctttaattttgacaacaatggtttcttcc |
219 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
33384140 |
acaaatttactttatcttccctcgtgcctttcatttgttcaccacc-----ttttgaaaacaatggtttcttcc |
33384072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University