View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_high_8 (Length: 417)
Name: NF18177_high_8
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 237 - 403
Target Start/End: Complemental strand, 44414505 - 44414339
Alignment:
| Q |
237 |
gtatgtagaggcaccctttaccttgaataccacactcaaattttgtccttacaacaatggaagtacttgctgcaactccatacaagatggacaaattcag |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44414505 |
gtatgtagaggcaccctttaccttgaataccacactcaaattttgtccttacaacaatggaagtacttgctgcaactccatacaagatggacaaattcag |
44414406 |
T |
 |
| Q |
337 |
aagcaattccaacagatgaatgtgtctgatactgcctgtgcctcacttttgaaatcaatactttgtg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44414405 |
aagcaattccaacagatgaatgtgtctgatactgcctgtgcctcacttttgaaatcaatactttgtg |
44414339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 11 - 118
Target Start/End: Complemental strand, 44414716 - 44414609
Alignment:
| Q |
11 |
atgaagactgttctttccacaggtttcttgttatgttgctcccttctgttcctacttttgggttcttcaacttcacttcctctatgtgttgactcaagta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44414716 |
atgaagactgttctttccacaggtttcttgttatgttgctcccttctgttcctacttttggattcttcaacttcacttcctctatgtgttgactcaagta |
44414617 |
T |
 |
| Q |
111 |
tgtatatc |
118 |
Q |
| |
|
|||||||| |
|
|
| T |
44414616 |
tgtatatc |
44414609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University