View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18177_low_20 (Length: 296)

Name: NF18177_low_20
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18177_low_20
NF18177_low_20
[»] chr3 (2 HSPs)
chr3 (13-164)||(3433107-3433258)
chr3 (202-251)||(3433296-3433345)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 3433107 - 3433258
Alignment:
13 aatatatcaatgattattaagtatttaaccgcaaaactcacacacactaaataagaaatggaaaattgtgggctcaaacttacacctcactatgttcaat 112  Q
    |||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||    
3433107 aatatatcaatgattattaagtgtttagccgcaaaactcacgcacactaaataagaaatggaaaattgtgggctcaaacttacacctcactatgggcaat 3433206  T
113 gtttttgcaacttattaccttcaaaggagtagttcttatgaaactatatatt 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3433207 gtttttgcaacttattaccttcaaaggagtagttcttatgaaactatatatt 3433258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 3433296 - 3433345
Alignment:
202 cctcttcttagttacgaggttataccaaatattcttaccgcattttaacc 251  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| |||||    
3433296 cctcttcttaattacgaggttataccaaatgttcttaccgcattgtaacc 3433345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University