View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_low_35 (Length: 226)
Name: NF18177_low_35
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_low_35 |
 |  |
|
| [»] scaffold0719 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 21146616 - 21146423
Alignment:
| Q |
17 |
acataaatcatttgttatatgaaaaagcagatttgttatgaagaatttgtatattaataagccctattatgcacttatccctttacaatgttttgggatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21146616 |
acataaatcatttgttatatgaaaaagcagatttgttatgaagaatttgtacattaataagccctattatgcacttatccctttacaatgttttgggatg |
21146517 |
T |
 |
| Q |
117 |
attgattacagcagatgaattgaaaaagccattgttcaatataagctaagcttattgcactaatgaactttaaaattatcattagatagatatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21146516 |
attgattacagcagatgaattgaaaaagccattgttcaatataagctaagcttattgcactaatgaactttaaaattatcactagatagatatt |
21146423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 21158745 - 21158668
Alignment:
| Q |
21 |
aaatcatttgttatatgaaaaagcagatttgttatgaagaatttgtatattaataagccctattatgcacttatccctt |
99 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||||||| || ||||||||| |||||||||||| ||||||| |
|
|
| T |
21158745 |
aaatcaattgtgatatgaaaaagcagagttgttatgaagaattt-tacattaataagtactattatgcactcatccctt |
21158668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 21314131 - 21314092
Alignment:
| Q |
105 |
tgttttgggatgattgattacagcagatgaattgaaaaag |
144 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21314131 |
tgttttgggatggttgattacagcagataaattgaaaaag |
21314092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 144
Target Start/End: Complemental strand, 33718347 - 33718252
Alignment:
| Q |
44 |
cagatttgttatgaagaatttgtatattaataagccctattatgcacttatccctttacaatgttttgggatgattgattacagcagatgaattgaaaaa |
143 |
Q |
| |
|
|||| |||||| ||||||||| || ||||||||||||||||| || || ||||||||||||||| ||||| |||| | | |||||||||||||||| |
|
|
| T |
33718347 |
cagagttgttaggaagaattt-tacattaataagccctatta----ctcattcctttacaatgttttcggatggctgatcagatcagatgaattgaaaaa |
33718253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 21258844 - 21258812
Alignment:
| Q |
130 |
gatgaattgaaaaagccattgttcaatataagc |
162 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
21258844 |
gatgaattgaaaaagtcattgttcaatataagc |
21258812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0719 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0719
Description:
Target: scaffold0719; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Complemental strand, 7054 - 7008
Alignment:
| Q |
121 |
attacagcagatgaattgaaaaagccattgttcaatataagctaagc |
167 |
Q |
| |
|
|||||| ||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
7054 |
attacaacagatgaattgaaaaagtcattattcaatctaagctaagc |
7008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0719; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 6956 - 6911
Alignment:
| Q |
122 |
ttacagcagatgaattgaaaaagccattgttcaatataagctaagc |
167 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
6956 |
ttacaacagatgaattgaaaaagtcattattcaatctaagctaagc |
6911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University