View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18177_low_37 (Length: 219)
Name: NF18177_low_37
Description: NF18177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18177_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 41659735 - 41659671
Alignment:
| Q |
145 |
actattgacaccaattcttgtgatccctaaggaaggaaaacataaaactgaaagttcttttcact |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41659735 |
actattgacaccaattcttgtcatccctaaggaaggaaaacataaaactgaaagttcttttcact |
41659671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 129 - 207
Target Start/End: Complemental strand, 41656731 - 41656653
Alignment:
| Q |
129 |
gtagaccctaaatcttactattgacaccaattcttgtgatccctaaggaaggaaaacataaaactgaaagttcttttca |
207 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41656731 |
gtagatcctaaatcttactattactaccaattctcttcatccctaaggaaggaaaacataaaactaaaagttcttttca |
41656653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University