View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_110 (Length: 267)
Name: NF18178_high_110
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_110 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 23692329 - 23692567
Alignment:
| Q |
19 |
gagcacgtatctgggctttcgaaatctttggtaggaagttcatatgcaactctttttcctggtgtgagccaagattgaatatcaggttcattctcacaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23692329 |
gagcacgtatctgggctttcgaaatctttggtaggaagttcatatgcaactctttttcctagtgtgagcgaagattgaatatcaggttcattctcacaga |
23692428 |
T |
 |
| Q |
119 |
aaatagatagtgttggctgcaggcataaaaggacacatggaattaacaatgataggataaatggaaaggatattgagtatattcaatggttataaaatat |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23692429 |
aagtagatagtgttggctgcaggcataaaaggacacatggaattagcaatgataggataaatggaaaggatattgagtatattcaatggttataaaatat |
23692528 |
T |
 |
| Q |
219 |
tatctaaacgtacagttgggatggttgacatggtttcaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23692529 |
tatctaaacgtacagttgggatggttgatatggtttcaa |
23692567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 19 - 118
Target Start/End: Original strand, 122522 - 122621
Alignment:
| Q |
19 |
gagcacgtatctgggctttcgaaatctttggtaggaagttcatatgcaactctttttcctggtgtgagccaagattgaatatcaggttcattctcacaga |
118 |
Q |
| |
|
||||| |||||||||||||||||||| | |||||||||| | ||||| |||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
122522 |
gagcatgtatctgggctttcgaaatcatcggtaggaagtgagtctgcaattcttttccctggtgtgagtgcagattgaatatcaggttcattctcacaga |
122621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University