View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_141 (Length: 237)
Name: NF18178_high_141
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_141 |
 | |
|
| [»] scaffold0655 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0655 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0655
Description:
Target: scaffold0655; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 6354 - 6546
Alignment:
| Q |
1 |
tctccttcttgttagtagacaattcttagacacaggaaatcaatgatcgatatggagatgagagagttaatattgagatttcagaatgagcaagtgactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354 |
tctccttcttgttagtagacaattcttagacacaggaaatcaatgatcgatatggagataagagagttaatattgagatttcagaatgagcaagtgactt |
6453 |
T |
|
| Q |
101 |
tcaatgtttttgaagcactacagttttgaaaaaatcttaaaatgtgtaacaaaattgatgttcttgagaaattagtcgcaaagcttatttagc |
193 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454 |
tcaatgtttttgaagcactagagttttgaaaaaatcttaacatgtgtaacaaaattgatgttcttgagaaattagtcgcaaagcttatttagc |
6546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University