View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_143 (Length: 236)
Name: NF18178_high_143
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_143 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 8506640 - 8506849
Alignment:
| Q |
13 |
gagatgagatagtgggaagggtgcggttgatttttgattcacaacgggagatgcaaactcgatcgatagataaagaaatgaagagatgtcgaaccctaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8506640 |
gagatgagatagtgggaagggtgcggttgattttttattcacaacgggagatgcaaactcgatcgatagataaagaaatgaagagatgtcgaaccctaga |
8506739 |
T |
 |
| Q |
113 |
agtcaataaaggagagatggcagcgaggctgacggcagcggaagaaaggttgatggtgacgggaggttagggtggcggatcggaaggtgaaaggaatata |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8506740 |
agtcaatataggagagatggcagcgaggctgacggcagcggaagaaaggttgatggtgacgggaggttagggtggcggatctgaaggtgaaaggaatata |
8506839 |
T |
 |
| Q |
213 |
tgaacaattt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
8506840 |
tgaacaattt |
8506849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 171
Target Start/End: Complemental strand, 51647507 - 51647353
Alignment:
| Q |
13 |
gagatgagatagtgggaagggtgcggttgatttttgattcacaacgggagatgcaaactcgatcgatagataaagaaatgaagagatgtcgaaccctaga |
112 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51647507 |
gagatgaaatagtgggaatggtgcggttgatttttgattcacaacgggagatgcaaactcgat----agataaagaaatgaagagatgtcgaaccctaga |
51647412 |
T |
 |
| Q |
113 |
agtcaataaaggagagatggcagcgaggctgacggcagcggaagaaaggttgatggtga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51647411 |
agtcaataaaggagagatggcagcgaggctgacgacagcggaagaaaggttgatggtga |
51647353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 32015165 - 32015323
Alignment:
| Q |
18 |
gagatagtgggaagggtgcggttgatttttgattcacaacgggagatgcaaactcgatcgatagataaagaaatgaagagatgtcgaaccctagaagtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| || | |||||||||||||||||||||||||| |||||| |
|
|
| T |
32015165 |
gagatagtgggaagggtgcggttgatgtttgattcacaaccggagatgcaaactcgactgaga----aagaaatgaagagatgtcgaaccctaaaagtca |
32015260 |
T |
 |
| Q |
118 |
ataaaggagagatggcagcgaggctgacggcagcggaagaaaggttgatggtgacgggaggtt |
180 |
Q |
| |
|
|||| ||||||| ||| ||||| |||| || ||||||||||||||||| ||| ||||||||| |
|
|
| T |
32015261 |
ataagggagagacagcaacgaggttgacagcggcggaagaaaggttgatagtggcgggaggtt |
32015323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 20602871 - 20602665
Alignment:
| Q |
13 |
gagatgagatagtgggaagggtgcggttgatttttgattcacaacgggagatgcaaactcgatcgatagataaagaaatgaagagatgtcgaaccctaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20602871 |
gagatgagatagtgggaagggtgcggttgatttttgattcacaacgggagatgcaaactcgat----agataaagaaatgaagagatgtcgaaccctaga |
20602776 |
T |
 |
| Q |
113 |
agtcaataaaggagagatggcagcgaggctgacggcagcggaagaaaggttgatggtgacgggaggttagggtggcggatcggaaggtg-aaaggaatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
20602775 |
agtcaataaaggagagatggcagcgaggctgacggcagtgaaagaaaggttgatggtgacgggaggttagggtggcggatctgaaggtgaaaaggaatat |
20602676 |
T |
 |
| Q |
212 |
atgaacaattt |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
20602675 |
atgaacaattt |
20602665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University