View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18178_high_150 (Length: 227)

Name: NF18178_high_150
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18178_high_150
NF18178_high_150
[»] chr8 (2 HSPs)
chr8 (136-227)||(31606901-31606992)
chr8 (1-42)||(31606826-31606867)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 136 - 227
Target Start/End: Original strand, 31606901 - 31606992
Alignment:
136 attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacat 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31606901 attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacat 31606992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 31606826 - 31606867
Alignment:
1 atggtttatttcaaaactttacaaattcaagtaaaattttgc 42  Q
    ||||||||||||||||||||||||  ||||||||||||||||    
31606826 atggtttatttcaaaactttacaagctcaagtaaaattttgc 31606867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University