View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_155 (Length: 218)
Name: NF18178_high_155
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_155 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 6250851 - 6251037
Alignment:
| Q |
19 |
ataaggtccattactttttctcccccttattaacttttggaatattgttggatttggaaacattannnnnnnnnnnnnaaaattgtagtggtgccatttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||| |||||| |
|
|
| T |
6250851 |
ataaggtccattactttttctcccccttattaactttgggaatattgttggatttggaaacattattgttttatttttaaaattgtagcggtgacatttt |
6250950 |
T |
|
| Q |
119 |
gataaatttcttcatgaaagaacaaattaatagttaaaatcgaaggttgttaatcgatttaatctctctatgtggagttactatatt |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6250951 |
gataaatttctttatgaaagaacaaattaatagttaaaatcgaaggttgttaatcgatttaatctctctatgtggagttactatatt |
6251037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University