View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_162 (Length: 205)
Name: NF18178_high_162
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_162 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 54918210 - 54918074
Alignment:
| Q |
1 |
gcatgagatcaaatggaaataaagccaaatgagacgaacattataaatccattgtgtctttgggaccttattcaagctggaacttttatatgagattata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54918210 |
gcatgagatcaaatggaaataaagccaaatgagacgaacat---aaatccattgtgtctttgggaccttattcaagctggaactcttatatgagattata |
54918114 |
T |
|
| Q |
101 |
ctagggttgttttgactaggtagcaagcacaaacttccac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54918113 |
ctagggttgttttgactaggtagcaagcacaaacttccac |
54918074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 54918037 - 54917989
Alignment:
| Q |
139 |
acgatttttgaatactagatgggatgaacaatggggtgatctgtctctg |
187 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
54918037 |
acgatttttgaatactaggtgggatgaacaatggggtgatttgtctctg |
54917989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University