View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_high_35 (Length: 467)
Name: NF18178_high_35
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 43 - 461
Target Start/End: Complemental strand, 2926672 - 2926252
Alignment:
| Q |
43 |
tgctctgttttagtttataaaattttaaggcgttttcctttgcaattaaaattttaatacattgcctagacgtagatctgtttgatctctgtatcagcga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926672 |
tgctctgttttagtttataaaattttaaggcgttttcctttgcaattaaaattttaatacattgcctagacgtagatctgtttgatctctgtatcagcga |
2926573 |
T |
 |
| Q |
143 |
cacttttaatcgaagacttgtacataatgttgtcgatgcgtctgt-----gtctgtgtctatgctgcatagtcttgcgatatatatgtgattata-aaat |
236 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2926572 |
cacttttaatggaagacttgtacataatgttgtcgatgcgtctgttgcgtgtctgtgtctatgatgcatagtcttgcgatatatatgtgattatacaaat |
2926473 |
T |
 |
| Q |
237 |
atttgatgtgttttgtgtgcgtgtgtggttgatgcagtggtgttggttatgtggcatatcgcgagttttatccatcggaagtggaggcggttaccgatag |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926472 |
atttgatgtgttttgtgtg----tgtggttgatgcagtggtgttggttatgtggcatatcgcgagttttatccatcggaagtggaggcggttaccgatag |
2926377 |
T |
 |
| Q |
337 |
gaaaaaagtggtggtgttgggaacaggatgggcggcaacaagttttatgaagaatctggacagtccaaagtatgaagtacaggtggtttcgcctcgtaac |
436 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926376 |
gaaaaaagtggtggtgctgggaacaggatgggcggcaacaagttttatgaagaatctggacagtccaaagtatgaagtacaggtggtttcgcctcgtaac |
2926277 |
T |
 |
| Q |
437 |
tattttgcattcactcctttgcttc |
461 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2926276 |
tattttgcattcactcctttgcttc |
2926252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University