View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_106 (Length: 288)
Name: NF18178_low_106
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 270
Target Start/End: Complemental strand, 29221510 - 29221253
Alignment:
| Q |
13 |
aatatgtgttactacatttgtcctacatcacccgtagtttgaaagtggttgtctctttgagaaagaaaatgcaaaagaaatatgtgacaatgttttcctg |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29221510 |
aatatgtgttactacacttgtcctacatcacccgtagtttgaaattggttgtctctttgagaaagaaaatgcaaaagaaatatgtgacaatgttttcctg |
29221411 |
T |
 |
| Q |
113 |
atgaatatattgctatggctgagttctaaaatttgtagccatctccgctgaacaatcagcatcttcatcttcctcatcatagtcatcgttatagccacgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29221410 |
atgaatatattgctatggctgagttctaaaatttgtagccatctccgctgaacaatcagcatcttcatcttcctcatcatagtcatcgtcatagccacgt |
29221311 |
T |
 |
| Q |
213 |
agccgctactttgatcttcccggagaatgtggtgacacctattgttggaacttcgaag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29221310 |
ggccgctactttgatcttcccggagaatgtggtgacacctattgttggaacttggaag |
29221253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University