View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_116 (Length: 265)
Name: NF18178_low_116
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_116 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 31456410 - 31456261
Alignment:
| Q |
1 |
attgaagtgtgctcactttacatttagttggatgcttgaagttttcagtgatcattacactaaagccttacatttggatagtgcatcagggagggaggtt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31456410 |
attgaagtgtgctcacttcacatttagttggatgcttgaagttttcagtgatcattacactaaagccttacatttggatagtgcatcagggagggaggtt |
31456311 |
T |
 |
| Q |
101 |
gagagagatgggaatatggtcatgtgcatacgagtttacttactttacct |
150 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
31456310 |
gagagagatgggaatatgattatgcgcatacgagtttacttactttacct |
31456261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 31456270 - 31456192
Alignment:
| Q |
177 |
tactttaccttgttggaggcaccatttttacagacaaaaacaatcagtatgttgatgcagtgtttctaaagtacctatg |
255 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31456270 |
tactttacctcgttggaggcaccatttttacagacaaaaacaatcagtatgttgatgcagtgtttctaaagtatctatg |
31456192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University