View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18178_low_116 (Length: 265)

Name: NF18178_low_116
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18178_low_116
NF18178_low_116
[»] chr3 (2 HSPs)
chr3 (1-150)||(31456261-31456410)
chr3 (177-255)||(31456192-31456270)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 31456410 - 31456261
Alignment:
1 attgaagtgtgctcactttacatttagttggatgcttgaagttttcagtgatcattacactaaagccttacatttggatagtgcatcagggagggaggtt 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31456410 attgaagtgtgctcacttcacatttagttggatgcttgaagttttcagtgatcattacactaaagccttacatttggatagtgcatcagggagggaggtt 31456311  T
101 gagagagatgggaatatggtcatgtgcatacgagtttacttactttacct 150  Q
    |||||||||||||||||| | ||| |||||||||||||||||||||||||    
31456310 gagagagatgggaatatgattatgcgcatacgagtttacttactttacct 31456261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 31456270 - 31456192
Alignment:
177 tactttaccttgttggaggcaccatttttacagacaaaaacaatcagtatgttgatgcagtgtttctaaagtacctatg 255  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
31456270 tactttacctcgttggaggcaccatttttacagacaaaaacaatcagtatgttgatgcagtgtttctaaagtatctatg 31456192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University