View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_124 (Length: 254)
Name: NF18178_low_124
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_124 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 1885303 - 1885057
Alignment:
| Q |
8 |
catcatcacaggttctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885303 |
catcatcacaggttctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataact |
1885204 |
T |
|
| Q |
108 |
gtcaacaagtcttgctactcttgctttagcattaaggttacatcccaatcccatatgtttctcagaaaatgactgtcttttcggactagaattttcagtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885203 |
gtcaacaagtcttgctactcttgctttagcattaaggttacatcccaatcccatatgtttctcagaaaatgactgtcttttcggactagaattttcagtc |
1885104 |
T |
|
| Q |
208 |
acttcttgtacaagaaaatgctcaagcagcctcataacaagatcaac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885103 |
acttcttgtacaagaaaatgctcaagcagcctcataacaagatcaac |
1885057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 37213870 - 37214003
Alignment:
| Q |
21 |
tctagctgattcaggcaaagcttcagcaagtacctgaaactttgtcaatgaaaggtttctatctcttgaaacctctgtaagataactgtcaacaagtctt |
120 |
Q |
| |
|
||||||||| ||||| |||||||| ||||| ||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| ||||| ||| |
|
|
| T |
37213870 |
tctagctgactcaggtaaagcttctgcaagaacctgaaactttgtcgatgaaaggtttctatctctagatacctctgtaagataactgtccacaagcctt |
37213969 |
T |
|
| Q |
121 |
gctactcttgctttagcattaaggttacatccca |
154 |
Q |
| |
|
|| |||||||| || ||||| ||||||| ||||| |
|
|
| T |
37213970 |
gccactcttgccttggcattcaggttacttccca |
37214003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University