View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_127 (Length: 250)
Name: NF18178_low_127
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_127 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 81 - 231
Target Start/End: Complemental strand, 41603495 - 41603348
Alignment:
| Q |
81 |
atgaacctcactgcatata-tatgctcgatctgattgtaaaacattggttagggttttgaatgaaagaaaaacatccctgtatcttatcaaggaaacatc |
179 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41603495 |
atgaacctcactgcatataatatgctc----tgattgtaaaacattggttagggttttgaatgaaagaaaaacatccctgtatcttatcaaagaaacatc |
41603400 |
T |
|
| Q |
180 |
attttaggtataaaaaataaacaatgtcgttttagggaatgtttgttccgac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41603399 |
attttaggtataaaaaataaacaatgtcgttttagggaatgtttgttccgac |
41603348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University