View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_131 (Length: 248)
Name: NF18178_low_131
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_131 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 5088307 - 5088550
Alignment:
| Q |
1 |
tgtatactcagttctatgtgtctaatttaagctttttgtccagtagctaaattgtgctgtgatttgtttagttggctgcacctttggagacattaggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5088307 |
tgtatactcagttctatgtgtctaatttaagctttttgtccagtagctaaattgtgctgtgatttgtttagttggctgcacctttggagacattaggaag |
5088406 |
T |
 |
| Q |
101 |
agctgcagctgaactacaaataaagaaacggactcatataggtaggtatatgcaaatccacaaaaggagcatgtgttctaccgaatacagttttatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5088407 |
agctgcagctgaactacaaataaagaaacggactcatataggtaggtatatgcaaatccacaaaaggagcatgtgttctaccgaatacagttttatgttt |
5088506 |
T |
 |
| Q |
201 |
aagttcacgttgtaaaatgtagctagctagcatgtgatgtgatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5088507 |
aagttcacgttgtaaaatgtagctagctagcatgtgatgtgatc |
5088550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University