View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_133 (Length: 246)
Name: NF18178_low_133
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_133 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 55271654 - 55271442
Alignment:
| Q |
18 |
gtttatcgtgttggtgaccttgagcgcaccattaagtatgtttaacttttgttagattattgattgcatgcttaaaatacatatataccatcatcatatt |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55271654 |
gtttatcgtgttggtgaccttgaacgcaccattaagtatgtttaacttttgttagattattgattgcatgcttaaaatacata----ccatcatcatatt |
55271559 |
T |
 |
| Q |
118 |
catattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55271558 |
catattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaa |
55271459 |
T |
 |
| Q |
218 |
cgcttttgttggatttg |
234 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
55271458 |
tgcttttcttggatttg |
55271442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 55265767 - 55265531
Alignment:
| Q |
18 |
gtttatcgtgttggtgaccttgagcgcaccattaagtatgtttaacttttgttagattattgattgcatgcttaaaatacatat-------------ata |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
55265767 |
gtttatcgtgttggtgaccttgaacgcaccattaagtatgtttaacttttgttagattattgattgcatgcttaaaatacaaaccatcatcataatcata |
55265668 |
T |
 |
| Q |
105 |
c-catcatcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgag |
203 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55265667 |
ttcatattcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgag |
55265568 |
T |
 |
| Q |
204 |
gagaaatatgccaacgcttttgttggatttgatgatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55265567 |
gagaaatatgccaacgcttttgttggatttggtgatg |
55265531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 145 - 234
Target Start/End: Complemental strand, 8303053 - 8302964
Alignment:
| Q |
145 |
tcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaacgcttttgttggatttg |
234 |
Q |
| |
|
|||||||||| ||||| ||| |||| ||||| ||||||||| | ||||||||||| ||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
8303053 |
tcaggttttacactgaagcttttggaatgaagcttttgaggaaaagagatgttccagaggagaaatacgccaatgcttttcttggatttg |
8302964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University