View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18178_low_136 (Length: 242)

Name: NF18178_low_136
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18178_low_136
NF18178_low_136
[»] chr4 (22 HSPs)
chr4 (1-224)||(40887704-40887927)
chr4 (3-221)||(46437808-46438026)
chr4 (3-185)||(50195143-50195325)
chr4 (3-184)||(50021820-50022001)
chr4 (3-184)||(55405610-55405791)
chr4 (25-224)||(41932061-41932259)
chr4 (3-184)||(30705670-30705851)
chr4 (3-184)||(51684878-51685059)
chr4 (2-184)||(50903113-50903295)
chr4 (10-182)||(11082489-11082661)
chr4 (38-180)||(70929-71071)
chr4 (18-184)||(44678120-44678286)
chr4 (3-185)||(50276914-50277096)
chr4 (75-184)||(21019721-21019830)
chr4 (35-184)||(40356555-40356704)
chr4 (18-184)||(37020441-37020607)
chr4 (35-185)||(41797194-41797344)
chr4 (35-184)||(30724890-30725039)
chr4 (75-184)||(1307291-1307400)
chr4 (75-184)||(6179959-6180068)
chr4 (75-184)||(49092214-49092323)
chr4 (75-184)||(31423532-31423641)
[»] chr6 (13 HSPs)
chr6 (12-200)||(21602154-21602341)
chr6 (12-221)||(6318723-6318932)
chr6 (43-184)||(2406517-2406658)
chr6 (11-184)||(24086934-24087107)
chr6 (74-184)||(2406320-2406430)
chr6 (35-185)||(27637501-27637651)
chr6 (23-184)||(31769838-31769997)
chr6 (75-184)||(6202942-6203051)
chr6 (75-184)||(11689909-11690018)
chr6 (75-184)||(22303023-22303132)
chr6 (75-184)||(30827773-30827882)
chr6 (18-221)||(3381834-3382038)
chr6 (18-108)||(26425210-26425300)
[»] chr8 (21 HSPs)
chr8 (3-200)||(5302426-5302623)
chr8 (3-180)||(37328437-37328614)
chr8 (2-224)||(22499605-22499826)
chr8 (7-180)||(35553342-35553515)
chr8 (3-184)||(5678703-5678884)
chr8 (3-185)||(39835545-39835727)
chr8 (30-184)||(45129426-45129580)
chr8 (23-157)||(25859344-25859478)
chr8 (36-184)||(15034921-15035069)
chr8 (12-184)||(39603044-39603216)
chr8 (30-184)||(21177425-21177579)
chr8 (3-184)||(39253768-39253949)
chr8 (12-184)||(34368748-34368919)
chr8 (12-184)||(43213129-43213301)
chr8 (3-185)||(43189683-43189865)
chr8 (75-184)||(42483643-42483752)
chr8 (75-184)||(23658-23767)
chr8 (75-184)||(487888-487997)
chr8 (75-184)||(1054319-1054428)
chr8 (75-184)||(23020442-23020551)
chr8 (75-184)||(26661240-26661349)
[»] chr1 (20 HSPs)
chr1 (74-224)||(19216720-19216870)
chr1 (3-180)||(38122812-38122989)
chr1 (43-180)||(47657553-47657690)
chr1 (18-180)||(45827334-45827496)
chr1 (11-184)||(49856153-49856326)
chr1 (3-184)||(51322416-51322597)
chr1 (3-185)||(19523404-19523586)
chr1 (3-185)||(21142721-21142903)
chr1 (3-184)||(23274384-23274565)
chr1 (3-200)||(35257053-35257250)
chr1 (3-185)||(47504083-47504265)
chr1 (7-157)||(50342220-50342370)
chr1 (12-184)||(22525741-22525913)
chr1 (35-184)||(19157755-19157904)
chr1 (3-180)||(52803663-52803840)
chr1 (35-184)||(13638155-13638304)
chr1 (12-184)||(96217-96389)
chr1 (12-184)||(31781761-31781932)
chr1 (75-184)||(26877485-26877594)
chr1 (75-184)||(3730500-3730609)
[»] chr3 (27 HSPs)
chr3 (3-221)||(48564619-48564837)
chr3 (11-184)||(30254208-30254381)
chr3 (18-185)||(41614025-41614192)
chr3 (3-185)||(50215227-50215409)
chr3 (3-184)||(20352283-20352464)
chr3 (3-184)||(44231462-44231642)
chr3 (3-185)||(17566301-17566481)
chr3 (12-184)||(47072319-47072491)
chr3 (3-184)||(50757848-50758021)
chr3 (3-184)||(48890410-48890591)
chr3 (3-184)||(49267498-49267679)
chr3 (3-154)||(42757867-42758018)
chr3 (12-184)||(36129215-36129387)
chr3 (4-126)||(16612564-16612686)
chr3 (4-126)||(22046567-22046689)
chr3 (35-185)||(46390704-46390854)
chr3 (75-184)||(52389680-52389789)
chr3 (12-184)||(2273207-2273379)
chr3 (12-184)||(3977413-3977585)
chr3 (12-184)||(4006545-4006717)
chr3 (3-185)||(598597-598778)
chr3 (35-184)||(29010752-29010901)
chr3 (75-184)||(34047218-34047327)
chr3 (75-184)||(42902311-42902420)
chr3 (75-184)||(54387918-54388027)
chr3 (96-184)||(50478928-50479016)
chr3 (75-184)||(49142669-49142778)
[»] chr5 (15 HSPs)
chr5 (42-184)||(20425606-20425748)
chr5 (3-202)||(42940472-42940670)
chr5 (6-185)||(5198632-5198811)
chr5 (74-184)||(8700539-8700649)
chr5 (3-151)||(38969794-38969942)
chr5 (11-142)||(40623237-40623368)
chr5 (12-184)||(7759082-7759255)
chr5 (75-184)||(8578694-8578803)
chr5 (35-185)||(19039317-19039467)
chr5 (75-184)||(27671845-27671954)
chr5 (35-184)||(28878378-28878527)
chr5 (121-202)||(42938743-42938824)
chr5 (35-184)||(28239872-28240021)
chr5 (102-175)||(7252189-7252262)
chr5 (102-175)||(23066399-23066472)
[»] chr7 (23 HSPs)
chr7 (3-185)||(27451818-27452000)
chr7 (11-184)||(9492989-9493162)
chr7 (3-180)||(37341990-37342166)
chr7 (3-184)||(39462119-39462300)
chr7 (3-184)||(36979281-36979462)
chr7 (3-184)||(5539444-5539625)
chr7 (3-184)||(11636399-11636580)
chr7 (3-185)||(34740480-34740662)
chr7 (35-184)||(15072426-15072575)
chr7 (11-184)||(47671328-47671496)
chr7 (92-184)||(11633318-11633410)
chr7 (35-184)||(42506087-42506236)
chr7 (78-185)||(19801209-19801316)
chr7 (75-184)||(17836762-17836871)
chr7 (35-184)||(17461417-17461566)
chr7 (35-184)||(17591648-17591797)
chr7 (71-185)||(16679286-16679399)
chr7 (71-185)||(17653522-17653635)
chr7 (75-184)||(9369557-9369666)
chr7 (75-184)||(35608546-35608655)
chr7 (75-184)||(41882333-41882442)
chr7 (75-184)||(48405151-48405260)
chr7 (92-157)||(13319084-13319149)
[»] chr2 (16 HSPs)
chr2 (3-185)||(36654623-36654805)
chr2 (38-200)||(29399746-29399908)
chr2 (35-184)||(28470290-28470439)
chr2 (45-184)||(40537321-40537459)
chr2 (18-184)||(7188568-7188734)
chr2 (35-185)||(17422237-17422387)
chr2 (75-184)||(22679324-22679433)
chr2 (75-184)||(39949283-39949392)
chr2 (39-184)||(45430497-45430642)
chr2 (12-184)||(10827052-10827223)
chr2 (75-184)||(43980314-43980423)
chr2 (75-184)||(3938909-3939018)
chr2 (75-184)||(5353800-5353909)
chr2 (35-184)||(15833009-15833158)
chr2 (75-184)||(30495116-30495225)
chr2 (75-184)||(43537859-43537968)
[»] scaffold0238 (1 HSPs)
scaffold0238 (3-122)||(17237-17356)
[»] scaffold0180 (1 HSPs)
scaffold0180 (75-200)||(14067-14192)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 22)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40887927 - 40887704
Alignment:
1 ataatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgacttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40887927 ataatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgacttt 40887828  T
101 atgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40887827 atgcgagaggtggcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 40887728  T
201 aaaaggatcatgttgagccatcca 224  Q
    ||||||||||||||||||||||||    
40887727 aaaaggatcatgttgagccatcca 40887704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 46437808 - 46438026
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||||||||||| ||||||||||| |||||  |||||||| || | ||||||||||||||| ||||||| |||    
46437808 aatcaggattggttttgggatccgcttagggcgagcgggttacatgatttgatttacctaggctacgccactatgcctcatgctttgctgatgactctat 46437907  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaa 202  Q
    ||||||||| |||| |||||||||||| ||||||| ||||  |||||||||||||| | ||||||||||| ||||||| |||  || |||||| |||| |    
46437908 gcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgaccgtgactttggatgacgtcgcatctcttatgcatcttcagattga 46438007  T
203 aaggatcatgttgagccat 221  Q
    | ||   ||||||||||||    
46438008 agggcggatgttgagccat 46438026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 50195143 - 50195325
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||| ||||||   ||||||| || |||||||||||| |||| ||||||| |||    
50195143 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttagtttacctgggctacgccactgtgcctcatgccttgctgatgactctat 50195242  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | || || ||||||||||||||||||    
50195243 gcgagaggtggcatcccgagaccatcacttttcacatgcccttgggggagatgactgtgaccttagatgatgtcgcatgtctg 50195325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 50022001 - 50021820
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||| | ||| ||||||| |||    
50022001 aatcaagattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgatctgctgatgactctat 50021902  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| ||||  ||||||||||| ||||||| ||||  |||||||||||||  | | |||||||||||||||||||||    
50021901 gcgagaggtggcatctcgagaccaacacttttcacatgcccttgggggagatgactgtgattttggatgatgtcgcatgtct 50021820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 55405791 - 55405610
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| | || ||||||| |||||||||||||||||  |||||||| || ||||||||||||| ||| ||||| | |||    
55405791 aatcaggattggttttgggatccgcttacggagagcgggttacatgatttggtttacctaggctacgccactgtgcctcatgctctgctgatgattctat 55405692  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| || |||||| || ||||||| ||||  ||||| |||||||  | ||||||||||||||| |||||||    
55405691 gcgagaggtggcatcccaagaccagcacttttcacatgcccttggggaagatgactgtgactttggatgatgtcacatgtct 55405610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 25 - 224
Target Start/End: Complemental strand, 41932259 - 41932061
Alignment:
25 cgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagac 124  Q
    |||| |||| ||||||| ||||||||||| ||||    ||||||| || ||||||||||||||||| ||||||| |||||||||||| |||| | |||||    
41932259 cgcttagggagagcgggttacatgatttgatttatctgggctacgccactgtgcctcatgctttgctgatgactctatgcgagaggtggcatcctgagac 41932160  T
125 caacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaaaaggatcatgttgagccatcca 224  Q
     | || ||||||| |||| || |||||||||||  | |||||||||||||||||||||||  || |||||| |||| || |||  |||||||||||||||    
41932159 tagcacttttcacatgcc-gttggggagatgactgtgactttggatgatgtcgcatgtcttatgcatcttcagattgaagggaggatgttgagccatcca 41932061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 30705670 - 30705851
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||  || ||||||||||||||||| |||||| ||||    
30705670 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacaccactgtgcctcatgctttgctgatgacattat 30705769  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | ||||||| |||| ||||||| | || |||||||  |    |||||||||||||  | |||||||||||||||||||||||    
30705770 gtgagaggtggcatcccgagacgagcacttttcacacggtcttgggggagatgactgtgactttggatgatgtcgcatgtct 30705851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 51684878 - 51685059
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||  |||||||||||||||||   || |||| || ||||||||||||  ||  ||||||| |||    
51684878 aatcaggattggttttgggatccgcttagggagagcggattacatgatttggtttacctgggttacgccactgtgcctcatgccctgttgatgactctat 51684977  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | ||||||||||||||| |||||||    
51684978 gcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcacatgtct 51685059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 2 - 184
Target Start/End: Original strand, 50903113 - 50903295
Alignment:
2 taatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgacttta 101  Q
    ||||||||| ||||| |||| |||||| |||| ||||| | ||||||| |||||||||    |||||| || ||||||||||||  ||| ||||||| ||    
50903113 taatcaggattggttttgggatccgcttagggagagcgagttacatgacttggtttacctgagctacgccactgtgcctcatgccctgctgatgactcta 50903212  T
102 tgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    || |||||||  ||| |||||||||||| ||||||| ||||  ||||||||||||   | |||||||||||||||||||||||    
50903213 tgtgagaggtgacatcccgagaccaacacttttcacatgcccttgggggagatgatagtgactttggatgatgtcgcatgtct 50903295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 10 - 182
Target Start/End: Complemental strand, 11082661 - 11082489
Alignment:
10 aatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagag 109  Q
    ||||||| |||||||| || | ||  |||||| |||||||||||||||||   ||||||| || |||||||||||| |||| |||||| |||||||||||    
11082661 aatggttttggggtcccctaaaggatagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgcgttgctgatgacattatgcgagag 11082562  T
110 gttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgt 182  Q
    || |||| ||| ||||| || ||||||| ||    |||||||||||||  | |||||||||||||||||||||    
11082561 gtggcatcccgcgaccagcagttttcacatggtcttgggggagatgactgtgactttggatgatgtcgcatgt 11082489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 38 - 180
Target Start/End: Original strand, 70929 - 71071
Alignment:
38 cgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcac 137  Q
    |||| ||||||||||||||| |   ||||||| || ||||||||||||||||| ||||||| |||| |||||||  ||| |||||||||||| |||||||    
70929 cgggttacatgatttggttttcttgggctacgccactgtgcctcatgctttgctgatgactctatgtgagaggtgacatcccgagaccaacacttttcac 71028  T
138 ttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
     ||||  |||||||||||||  | |||||||||||||| ||||    
71029 atgcccatgggggagatgactgtgactttggatgatgttgcat 71071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 44678286 - 44678120
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| ||||||| ||||||| ||||||||    ||||||| ||  |||||||||||  ||| ||||||| |||||||||||| ||||     
44678286 tgggatccgcttagggagagcgggttacatgacttggtttatctgggctacgccaccgtgcctcatgccctgctgatgactctatgcgagaggtggcatc 44678187  T
118 ccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | ||||||| ||  |||||| ||||  |||||||||| ||  | || ||||||||||||||||||||    
44678186 ctgagaccagcacctttcacatgcccttgggggagataactgtgacattggatgatgtcgcatgtct 44678120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 50276914 - 50277096
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| | ||||| |||||||||   ||||||| || |||| |||||||  ||| ||||||| |||    
50276914 aatcaggattggttttgggatccgcttagggagagcgggttgcatgacttggtttacctgggctacgccactgtgtctcatgccctgctgatgactctat 50277013  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| | ||  |||||||| ||  |||||| | ||  || ||||||||||  | || |||||||||||||||||||||    
50277014 gcgagaggtggtatctcgagaccagcacatttcacattcccttgagggagatgactgtgaccttggatgatgtcgcatgtctg 50277096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 21019830 - 21019721
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  |||||||||||||  | || ||||||||||    
21019830 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 21019731  T
175 tcgcatgtct 184  Q
    ||||||||||    
21019730 tcgcatgtct 21019721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 40356704 - 40356555
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||   |  |||||||||||  ||| ||||||||||| |||||||| |||| | ||||||| ||  |||    
40356704 gagcgggctacatgatttggtttacttggggtactctaccgtgcctcatgccctgctgatgactttatacgagaggtggcatccggagaccagcaccttt 40356605  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  ||||||||||| | || || ||||||||||||||||||||    
40356604 cacatgcccatgggggagatgtctatgacattggatgatgtcgcatgtct 40356555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 37020607 - 37020441
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||| ||  |||||||||||  ||| ||||||| ||| | |||||| ||||     
37020607 tgggatccgcttagggagagcgggttacatgacttggtttacctgggctacgccaccgtgcctcatgccctgctgatgactctatacaagaggtggcatc 37020508  T
118 ccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| ||  |||||| || |  |||||||||||||  | || ||||||||||| ||||||||    
37020507 ccgagaccagcacctttcacatgtccttgggggagatgactgtgacattggatgatgttgcatgtct 37020441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 41797344 - 41797194
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
41797344 gagcgggctacatgatttggtatacttggggtactccaccgtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 41797245  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||| ||||  |||||||||||||  | || |||||||||||||||||||||    
41797244 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtctg 41797194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 30725039 - 30724890
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||| ||||||||||||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||||||  ||     
30725039 gagcgggctacacgatttggtttacttggggtactccaccgtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccaacaccttc 30724940  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||| ||||||||||    
30724939 cacatgccgatgggggagatgactgtgacattggatgatttcgcatgtct 30724890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 1307400 - 1307291
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
1307400 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 1307301  T
175 tcgcatgtct 184  Q
    ||||||||||    
1307300 tcgcatgtct 1307291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 6180068 - 6179959
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
6180068 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 6179969  T
175 tcgcatgtct 184  Q
    ||||||||||    
6179968 tcgcatgtct 6179959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 49092214 - 49092323
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
49092214 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 49092313  T
175 tcgcatgtct 184  Q
    ||||||||||    
49092314 tcgcatgtct 49092323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 31423532 - 31423641
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||    || ||||||||||    
31423532 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgcgacattggatgatg 31423631  T
175 tcgcatgtct 184  Q
    ||||||||||    
31423632 tcgcatgtct 31423641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 13)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 12 - 200
Target Start/End: Original strand, 21602154 - 21602341
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||  |||||| |||| |||||||    
21602154 tggttttggggtccgcttagggcgagcgggctacatgatttggtttacacaggctacgccactgtgcctcatgctttgcatatgactctatgtgagaggt 21602253  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 200  Q
     |||| ||||||||| || ||||||||||||||| |||||||||||||||||||| |||||||| |  ||||||||| |||||| ||||    
21602254 ggcatgccgagaccagcagttttcacttgcctgt-ggggagatgaccattacttttgatgatgttgtctgtctgttgcatcttccgatt 21602341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 6318932 - 6318723
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || | ||||||||||| | | ||||||| ||||||||||||    
6318932 tggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactatgcctcatgctctactgatgactctatgcgagaggt 6318833  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaaaaggatcat 211  Q
     |||| |||||||||||| ||||||| ||||  |||||||||||||  | |||||||||||||||||||||||  || |||||| |||| || |||  ||    
6318832 ggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtcttatgcatcttcagattgaagggaggat 6318733  T
212 gttgagccat 221  Q
    ||||||||||    
6318732 gttgagccat 6318723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 43 - 184
Target Start/End: Complemental strand, 2406658 - 2406517
Alignment:
43 tacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcc 142  Q
    |||||||||||||||||   ||||||| || ||||||||||||  ||| ||||||| |||||||||||| |||| ||||||||| || ||||||| ||||    
2406658 tacatgatttggtttacctgggctacgccactgtgcctcatgccctgcagatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcc 2406559  T
143 tgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
      |||||||||||||  | |||||||||||||||||||||||    
2406558 cttgggggagatgactgtgactttggatgatgtcgcatgtct 2406517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 24087107 - 24086934
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| |||||| |||| ||||| | |||||||||| |||| |    |||||| || ||||||||||||||||| ||||||| |||||||||||    
24087107 atggttttgggatccgcttagggagagcgagttacatgattttgttttcttgtgctacgccactgtgcctcatgctttgctgatgactctatgcgagagg 24087008  T
111 ttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | || | |||| |||| || ||||||| ||||  |||||||||||||| | |||||||| ||||||||||||||    
24087007 tggcttcccgaaaccagcacttttcacatgcccatgggggagatgaccgtgactttggaggatgtcgcatgtct 24086934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 74 - 184
Target Start/End: Original strand, 2406320 - 2406430
Alignment:
74 tgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgat 173  Q
    ||||||||||||  ||| ||||||| |||||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | ||||||||||||    
2406320 tgtgcctcatgccctgcagatgactctatgcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgat 2406419  T
174 gtcgcatgtct 184  Q
    |||||||||||    
2406420 gtcgcatgtct 2406430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 185
Target Start/End: Original strand, 27637501 - 27637651
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
27637501 gagcgggctacatgatttggtttacttggggtactccaccgtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 27637600  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||| ||||  |||||||||||||  | || |||||||||||||||||||||    
27637601 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtctg 27637651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 31769838 - 31769997
Alignment:
23 tccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgag 122  Q
    |||||| |||| ||||||| ||||||| ||||| ||    ||||||| || ||||||||||||  ||| ||||||| |  ||||||||| |||| |||||    
31769838 tccgcttagggagagcgggttacatgacttggtatatctgggctacgccactgtgcctcatgccatgctgatgactct--gcgagaggtggcatcccgag 31769935  T
123 accaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    |||||||  |||||| ||||  || ||||||||||  | || ||||||||||||||||||||    
31769936 accaacacctttcacatgcccttgtgggagatgactgtgaccttggatgatgtcgcatgtct 31769997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 6202942 - 6203051
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
6202942 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 6203041  T
175 tcgcatgtct 184  Q
    ||||||||||    
6203042 tcgcatgtct 6203051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 11689909 - 11690018
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
11689909 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 11690008  T
175 tcgcatgtct 184  Q
    ||||||||||    
11690009 tcgcatgtct 11690018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 22303023 - 22303132
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
22303023 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 22303122  T
175 tcgcatgtct 184  Q
    ||||||||||    
22303123 tcgcatgtct 22303132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 30827882 - 30827773
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
30827882 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 30827783  T
175 tcgcatgtct 184  Q
    ||||||||||    
30827782 tcgcatgtct 30827773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 3381834 - 3382038
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| |||||   |||||||||| ||||||   || |||| || |||| ||||||||||||  ||||| ||||||||||||| ||||     
3381834 tgggatccgcttagggagagcgatttacatgatttagtttacctgggatacgccattgtgtctcatgctttgctaatgacattatgcgagaggtggcatc 3381933  T
118 ccgagaccaacaattttcac-ttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaaaaggatcatgttga 216  Q
    ||||||| | ||  ||||||   | ||  |||||||||||   | |||||||||||||||||||||||  || |||||| |||| || ||   |||||||    
3381934 ccgagactagcagctttcacacggtcttggggggagatgattgtgactttggatgatgtcgcatgtcttatgcatcttcagattgaagggcggatgttga 3382033  T
217 gccat 221  Q
    |||||    
3382034 gccat 3382038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 26425210 - 26425300
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgaga 108  Q
    |||| |||||| |||| ||||| |||||||||||| ||||||   || |||  || ||||||||||||  ||| |||||||||||||||||    
26425210 tgggatccgcttagggagagcgagctacatgatttagtttacttggggtactccactgtgcctcatgccctgctgatgactttatgcgaga 26425300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 200
Target Start/End: Complemental strand, 5302623 - 5302426
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| ||| || |||| ||||||  |||||||||||||||||  |||||||  || |||||||||||| |||| ||||||| |||    
5302623 aatcaggattggttttgggatcctcttagggagagcggattacatgatttggtttacctaggctacaccactgtgcctcatgccttgctgatgactctat 5302524  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 200  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  ||||||||||||| || |||||||||||||||||||||||  ||||||||| ||||    
5302523 gcgagaggtggcatcccgagaccatcacttttcacatgcccttgggggagatgactatgactttggatgatgtcgcatgtcttatgtatcttcagatt 5302426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 180
Target Start/End: Original strand, 37328437 - 37328614
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||||||||| ||||||| |||    
37328437 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgctttgctgatgactctat 37328536  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | |||||||||||||||||||    
37328537 gcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcat 37328614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 2 - 224
Target Start/End: Original strand, 22499605 - 22499826
Alignment:
2 taatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgacttta 101  Q
    ||||||| |||| || || | |||| |||||||||||||    ||||| ||  |||| |||||||||| || |||||||||||||||||  ||||||||     
22499605 taatcagaaatgcttttgagatccgatgagggcgagcggttgtcatgaatttatttatacaggctacgccagtgtgcctcatgctttgct-atgactttg 22499703  T
102 tgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatta 201  Q
    |||||||||| |||||| ||||||||||  |||||||||||||| ||||||||||||||||||||||||||| |||| ||||| ||| || |||  |||     
22499704 tgcgagaggtggcatactgagaccaacagatttcacttgcctgtaggggagatgaccattactttggatgatatcgcctgtctattgcatattcccattg 22499803  T
202 aaaggatcatgttgagccatcca 224  Q
    || ||||||||||||| ||||||    
22499804 aagggatcatgttgagtcatcca 22499826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 180
Target Start/End: Original strand, 35553342 - 35553515
Alignment:
7 aggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcga 106  Q
    |||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||  || ||||| || ||||||||||||||||  ||||||| |||||||    
35553342 aggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctagactacgccactgtgcctcatgctttgttgatgactctatgcga 35553441  T
107 gaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
     |||| |||| ||||||||| || ||||||| ||||| |||||||||||||  | |||||||||||||||||||    
35553442 aaggtggcatcccgagaccagcacttttcacatgcctttgggggagatgactgtgactttggatgatgtcgcat 35553515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 5678703 - 5678884
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||||||  |||| |||||||| || | || ||||||| |||||||||||||||||   ||||||| || | ||||||||||||||| ||||||| |||    
5678703 aatcaggataggttttggggtcctcttacggagagcgggttacatgatttggtttacttgggctacgccactatgcctcatgctttgctgatgactctat 5678802  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||||||| |||| |||||| || || ||||||| ||||  |||||||||||||| ||||| ||||||||||| |||||||    
5678803 acgagaggtggcatcccgagagcagcacttttcacatgcccttgggggagatgaccgttactctggatgatgtctcatgtct 5678884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 39835727 - 39835545
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| || | |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||| ||||  ||| ||||||| |||    
39835727 aatcaggattggttttgtgatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgccttatgccctgctgatgactctat 39835628  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||| | |||| ||||||||| || ||||||| ||||  ||||||||||||   | || |||||||||||||||||||||    
39835627 gcgagagatggcatcccgagaccagcacttttcacatgcccttgggggagatgattgtcaccttggatgatgtcgcatgtctg 39835545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 30 - 184
Target Start/End: Original strand, 45129426 - 45129580
Alignment:
30 agggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaaca 129  Q
    |||| ||||||| ||||||||||||||||    ||||||| || |||| |||||||||||| ||||||| |||| ||||||| |||| ||||||||  ||    
45129426 agggagagcgggttacatgatttggtttatctgggctacgccattgtgtctcatgctttgctgatgactctatgtgagaggtggcatcccgagaccggca 45129525  T
130 attttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     ||||||| ||||  ||||||||||||   | |||||||||||||||||||||||    
45129526 cttttcacatgccattgggggagatgattgtgactttggatgatgtcgcatgtct 45129580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 23 - 157
Target Start/End: Complemental strand, 25859478 - 25859344
Alignment:
23 tccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgag 122  Q
    |||||| |||| ||||||| |||||||||||||||||   ||||||| || | ||||||||||  ||| ||||||| |||||||||||| |||| || ||    
25859478 tccgcttagggagagcgggttacatgatttggtttaccttggctacgccactttgcctcatgccctgctgatgactctatgcgagaggtcgcatcccaag 25859379  T
123 accaacaattttcacttgcctgtgggggagatgac 157  Q
    |||| || ||||||| ||||  |||||||||||||    
25859378 accagcacttttcacatgcccttgggggagatgac 25859344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 36 - 184
Target Start/End: Complemental strand, 15035069 - 15034921
Alignment:
36 agcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttc 135  Q
    |||||||||||||| |||||||||   || |||  ||  |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  ||||    
15035069 agcgggctacatgacttggtttacttggggtacttcaccgtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttc 15034970  T
136 acttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    || ||||  |||||||||||||  | || ||||||||||||||||||||    
15034969 acatgcccatgggggagatgactgtgacattggatgatgtcgcatgtct 15034921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 39603044 - 39603216
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||| ||  ||||| |||||  | | ||||||| ||||||||| ||    
39603044 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggctacgccaccgtgccgcatgccctactgatgactctatgcgagatgt 39603143  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| ||||||||| ||  |||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
39603144 ggcatcccgagaccagcacctttcacatgcccttgggggagatgactgtgacattggatgatgtcgcatgtct 39603216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 184
Target Start/End: Complemental strand, 21177579 - 21177425
Alignment:
30 agggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaaca 129  Q
    |||| ||||||| ||||||||||| |||||   ||||||  ||  ||| |||||| ||||| ||||||  |||||||||| | |||| ||||||| | ||    
21177579 agggagagcgggttacatgatttgatttacctgggctacaccaccgtgtctcatgttttgctgatgacgctatgcgagagttggcatcccgagacaagca 21177480  T
130 attttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     ||||||| ||||  |||||||||||||  | |||||||||||||||||||||||    
21177479 cttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtct 21177425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 39253768 - 39253949
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||| | ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  | | |||||||||||    
39253768 aatcagaattggttttgggatccgcttagggagagcgggttacatgacttggtttacttcgggtactccaccgtgcctcatgccctactgatgactttat 39253867  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| | ||||||| ||  |||||| |||   |||||||||||||  | || ||||||||||||||||||||    
39253868 gcgagaggtggcatcctgagaccagcacctttcacatgcacatgggggagatgactgtgacattggatgatgtcgcatgtct 39253949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 34368919 - 34368748
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||| ||  |||||||||||  ||| ||||||| ||||||||||||    
34368919 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggctacgccaccgtgcctcatgccctgctgatgactctatgcgagaggt 34368820  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  | |||||||||||  | || ||||||||||| ||||||||    
34368819 ggcatcctgagaccagcacctttcacatgcc-cttggggagatgactgtgacattggatgatgttgcatgtct 34368748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 43213129 - 43213301
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  ||| ||||||||||||||||||||    
43213129 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgctgatgactttatgcgagaggt 43213228  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  |||||||||||||  | || ||||||||||| ||||||||    
43213229 ggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatgttgcatgtct 43213301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 43189683 - 43189865
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||| | ||||| |||| |||||| |||| ||||||| || ||| ||||||||||    |||||  || ||||||| ||||  | | ||||||| | |    
43189683 aatcagtattggttttgggatccgcttagggagagcgggttagatggtttggtttacctgagctacaccactgtgcctaatgccctactgatgactctgt 43189782  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | || ||||||||||||| |||||||    
43189783 gcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgaccttggatgatgtcgtatgtctg 43189865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 42483752 - 42483643
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    ||||||||||| |||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
42483752 gtgcctcatgccttgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 42483653  T
175 tcgcatgtct 184  Q
    ||||||||||    
42483652 tcgcatgtct 42483643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 23767 - 23658
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
23767 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcagcttccacatgccgatgggggagatgactgtgacattggatgatg 23668  T
175 tcgcatgtct 184  Q
    ||||||||||    
23667 tcgcatgtct 23658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 487997 - 487888
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
487997 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcatcttccacatgccgatgggggagatgactgtgacattggatgatg 487898  T
175 tcgcatgtct 184  Q
    ||||||||||    
487897 tcgcatgtct 487888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 1054319 - 1054428
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
1054319 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 1054418  T
175 tcgcatgtct 184  Q
    ||||||||||    
1054419 tcgcatgtct 1054428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 23020551 - 23020442
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
23020551 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 23020452  T
175 tcgcatgtct 184  Q
    ||||||||||    
23020451 tcgcatgtct 23020442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 26661240 - 26661349
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
26661240 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 26661339  T
175 tcgcatgtct 184  Q
    ||||||||||    
26661340 tcgcatgtct 26661349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 20)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 74 - 224
Target Start/End: Original strand, 19216720 - 19216870
Alignment:
74 tgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgat 173  Q
    ||||||||||||||||  |||||||||||||||| ||| ||||||||||||||||| ||||||||| |||||| ||||||||||  ||||||||||||||    
19216720 tgtgcctcatgctttgatgatgactttatgcgagcggtggcataccgagaccaacatttttcactttcctgtgagggagatgacggttactttggatgat 19216819  T
174 gtcgcatgtctgttgtatcttctgattaaaaggatcatgttgagccatcca 224  Q
    |||  |||||||||| || |||  ||| || ||||||||||||||||||||    
19216820 gtcagatgtctgttgcatattcccattgaagggatcatgttgagccatcca 19216870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 3 - 180
Target Start/End: Complemental strand, 38122989 - 38122812
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||  |||||||||||||||||   || |||| ||||||||||||||||||| |||||||| |||    
38122989 aatcatgattggttttgggatccgcttagggagagcggattacatgatttggtttacctgggttacgccaatgtgcctcatgctttgtcgatgactctat 38122890  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
    ||||||||| |||| |||||||||||| ||||||| ||||  |||||||||||||  | |||||||||||||||||||    
38122889 gcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcat 38122812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 43 - 180
Target Start/End: Original strand, 47657553 - 47657690
Alignment:
43 tacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcc 142  Q
    |||||||||||||||||   ||||||| || ||||||||||||||||| ||||||| |||||||||||| |||| |||||||||||| ||||||| ||||    
47657553 tacatgatttggtttacctgggctacgccactgtgcctcatgctttgctgatgactctatgcgagaggtagcatcccgagaccaacacttttcacatgcc 47657652  T
143 tgtgggggagatgaccattactttggatgatgtcgcat 180  Q
      |||||||||||||  | |||||||||||||||||||    
47657653 cttgggggagatgactgtgactttggatgatgtcgcat 47657690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 45827334 - 45827496
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||||| ||| ||||||| |||||||||||| ||||     
45827334 tgggatccgctcagggagagcgggttacatgatttggtttacctgggctacgccattgtgcctcatgctctgctgatgactctatgcgagaggtggcatc 45827433  T
118 ccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
    | ||||||| || ||||||| ||||  |||||||||||||  | |||||||||||||||||||    
45827434 ctgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcat 45827496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 49856326 - 49856153
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| |||||| | || |||| || |||||||||| |||| |   ||||||| || ||||||||||| ||||| ||||||| |||||||||||    
49856326 atggttttgggatccgcttaaggagagcaggttacatgattttgttttcttgggctacgccattgtgcctcatgttttgctgatgactctatgcgagagg 49856227  T
111 ttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | |||| |||||||||||| ||||||| ||||  |||||||||||||| | |||||||| ||||||||||||||    
49856226 tggcatcccgagaccaacacttttcacatgcccatgggggagatgaccgtgactttggaggatgtcgcatgtct 49856153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 51322416 - 51322597
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| || |||||||| |||| ||||||| ||||||||||||||| |   ||||||| || ||||||||||||||||| ||||||| |||    
51322416 aatcaggattggttttgaggtccgcttagggagagcgggttacatgatttggttttcctgggctacgccactgtgcctcatgctttgctgatgactctat 51322515  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||| | |||| |  |||||| || ||||||| |||   |||||||||||||| | |||||||| ||||||||||||||    
51322516 gcgagagatggcatcctaagaccagcacttttcacatgctcatgggggagatgaccgtgactttggaggatgtcgcatgtct 51322597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 19523586 - 19523404
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||| || ||||||||||||  ||| ||||||| |||    
19523586 aatcaggattggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggctacgccactgtgcctcatgccgtgctgatgactctat 19523487  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| | ||||||| ||  |||||| ||||  |||||||||||||  | |  |||||||||||||||||||||    
19523486 gcgagaggtggcatccggagaccagcacctttcacatgcccttgggggagatgactgtgatcttggatgatgtcgcatgtctg 19523404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 21142721 - 21142903
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| || ||| |||| ||||||| ||||||| |||||||||  |||||||| || | ||||||||||  ||| ||||||| |||    
21142721 aatcaggattggttttgggatcagcttagggagagcgggttacatgacttggtttacctaggctacgccactatgcctcatgccctgctgatgactctat 21142820  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
     |||||||| |||| ||||||||| ||  |||||| ||||  |||||||||||||  | || |||||||||||||||||||||    
21142821 acgagaggtggcatcccgagaccagcacctttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtctg 21142903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 23274565 - 23274384
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||| | ||||  |||||  |||||||||||||||||   ||||||| || ||||||||||||  |   ||||||| |||    
23274565 aatcaggattggttttgggatccgtttagggacagcggattacatgatttggtttaccagggctacgccactgtgcctcatgccctaatgatgactctat 23274466  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| | |||||||||| ||||||| ||||  |||||||||||||  | |||||||||||||||||||||||    
23274465 gcgagaggtggcatcctgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtct 23274384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 3 - 200
Target Start/End: Complemental strand, 35257250 - 35257053
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| || ||| |||| |||| ||||||| ||||||||||||||| |   ||| ||| || | |||||| |||||||| |||| || |||    
35257250 aatcaggattggttttgaggttcgcttagggagagcgggttacatgatttggttttcctgggcaacgccactatgcctcgtgctttgctgatggctctat 35257151  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 200  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  ||||||||||||   | |||||||| ||||||||||||||  || |||||||||||    
35257150 gcgagaggtggcatcccgagaccatcacttttcacatgcccatgggggagatgattgtgactttggaggatgtcgcatgtcttatgcatcttctgatt 35257053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 47504083 - 47504265
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| | || |||||| |||| ||||||| ||||||||||||||| |   ||||||| ||  |||||||||||  ||| ||||||| |||    
47504083 aatcaggattggttttcggatccgcttagggagagcgggttacatgatttggtttgcctgggctacgccaccgtgcctcatgccctgctgatgactctat 47504182  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    | ||||||| |||| ||||||||| || ||||||| ||||  | |||||||||||  | || |||||||||||||||||||||    
47504183 gagagaggtggcatcccgagaccagcacttttcacatgcccttaggggagatgactgtgaccttggatgatgtcgcatgtctg 47504265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 50342370 - 50342220
Alignment:
7 aggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcga 106  Q
    |||| ||||| |||| |||||| |||| ||||||| ||||||||||||||||| | ||||||| || ||||||||||||  | | ||||||| |||||||    
50342370 aggattggttttgggatccgcttagggagagcgggttacatgatttggtttacccgggctacgccactgtgcctcatgccctactgatgactctatgcga 50342271  T
107 gaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgac 157  Q
    ||||| |||| || ||||||  | ||||||| ||||  |||||||||||||    
50342270 gaggtggcatcccaagaccagtacttttcacatgcccttgggggagatgac 50342220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 22525741 - 22525913
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  ||| ||||||||||||||||||||    
22525741 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgctgatgactttatgcgagaggt 22525840  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||| |||||||||| ||  | || ||||||||||||||||||||    
22525841 ggcatcctgagaccagcacctttcacatgcctttgggggagataactgtgacattggatgatgtcgcatgtct 22525913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 19157755 - 19157904
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||| |||||||||   || |||  ||  |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||    
19157755 gagcgggctacatgacttggtttacttggggtactccaccgtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcaccttt 19157854  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  ||||| |||||||  | || ||||||||||||||||||||    
19157855 cacatgcccatggggaagatgactgtgacattggatgatgtcgcatgtct 19157904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 3 - 180
Target Start/End: Original strand, 52803663 - 52803840
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||| ||||||| |||||||||  |||||| | || ||||||||||||  ||| ||||| | |||    
52803663 aatcaagattggttttgggatccgcttagggagagcgggttacatgacttggtttacctaggctaagccactgtgcctcatgccctgctgatgattctat 52803762  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
    |||||||||  ||| || |||||| ||  |||||| ||||  ||||||||||||   | || ||||||||||||||||    
52803763 gcgagaggtgacatcccaagaccagcacctttcacatgcccttgggggagatgattgtgaccttggatgatgtcgcat 52803840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 13638304 - 13638155
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  ||     
13638304 gagcgggctacatgatttggtttacttggggtactccatcgtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttc 13638205  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
13638204 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 13638155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 96389 - 96217
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   || |||  ||  |||| ||||||| ||| ||||||| ||||||||||||    
96389 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggatactccaccgtgcttcatgctctgctgatgactctatgcgagaggt 96290  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  | |||||||||||  | || ||||||||||| ||||||||    
96289 ggcatcctgagaccagcacctttcacatgccctttggggagatgactgtgacattggatgatgttgcatgtct 96217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 31781932 - 31781761
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| |||| || ||||||| |||||||||   || |||  ||  |||||||||||  ||  ||||||||||||||||||||    
31781932 tggttttgggatccgcttagggagagcaggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgttgatgactttatgcgagaggt 31781833  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  ||||||||||||  || || ||||||||||||||||||||    
31781832 ggcatcctgagaccagcacatttcacatgcccatgggggagatga-tatgacattggatgatgtcgcatgtct 31781761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 26877485 - 26877594
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
26877485 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 26877584  T
175 tcgcatgtct 184  Q
    ||||||||||    
26877585 tcgcatgtct 26877594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 3730609 - 3730500
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | ||| |||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
3730609 gtgcctcatgccctgctgcttactatatgcgagaggtggcatccggagaccagcagcttccacatgccgatgggggagatgactgtgacattggatgatg 3730510  T
175 tcgcatgtct 184  Q
    ||||||||||    
3730509 tcgcatgtct 3730500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 27)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 48564619 - 48564837
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||||| ||| ||||||| |||    
48564619 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgctctgctgatgactctat 48564718  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaa 202  Q
    ||||||||| |||| |||||||||||| ||||||| ||||  | ||| |||||||  | |||||||||||||| |||||| |  || |||||| ||||||    
48564719 gcgagaggtggcatcccgagaccaacacttttcacatgcccttcgggaagatgactgtgactttggatgatgttgcatgttttatgcatcttcagattaa 48564818  T
203 aaggatcatgttgagccat 221  Q
    | ||   ||||||||||||    
48564819 agggcgaatgttgagccat 48564837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 30254381 - 30254208
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| |||||| | || ||||||| ||||||||||||||| |   ||||||| || |||||||||||||||||  |||||| |||||||||||    
30254381 atggttttgggatccgcttaaggagagcgggttacatgatttggttttcttgggctacgccactgtgcctcatgctttgctaatgactctatgcgagagg 30254282  T
111 ttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | |||| ||||||||| || ||||||| ||||  |||||||||||||||| |||||||| ||||||||||||||    
30254281 tggcatcccgagaccagcacttttcacatgcccatgggggagatgaccatgactttggaggatgtcgcatgtct 30254208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 41614025 - 41614192
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| ||| ||| |||||||||||||||||   ||||||| || ||||||||||||  ||| ||||||| |||||||||||| ||||     
41614025 tgggatccgcttagggagagagggttacatgatttggtttacctgggctacgccactgtgcctcatgccatgctgatgactctatgcgagaggtggcatc 41614124  T
118 ccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    |||||||||||| ||||||| ||||  |||||||||||||  | || |||||||||||||||||||||    
41614125 ccgagaccaacacttttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtctg 41614192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 50215409 - 50215227
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| |||| || |||||||||||||||||   ||||||| ||||||||||||||   ||| ||||||| |||    
50215409 aatcaggattggttttgggatccgcttagggagagcaggttacatgatttggtttacctgggctacgccaatgtgcctcatgtcatgctgatgactctat 50215310  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| | ||||||| ||  |||||| ||||| |||||||||||||  | || ||||||||||||| |||||||    
50215309 gcgagaggtggcatcctgagaccagcacctttcacatgcctttgggggagatgactgtgaccttggatgatgtcgaatgtctg 50215227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 20352283 - 20352464
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || |||||||||||| ||||  |||||| |||    
20352283 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgccttgctaatgactctat 20352382  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| | || ||| ||| | || ||||||| ||||  |||||||||||||  | ||||||||||||||||| |||||    
20352383 gcgagaggtggtatcccgtgactagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcgtgtct 20352464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 44231462 - 44231642
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| ||| || ||||  |||||| |||||||||||||||||   ||||||| || ||||||||||||  ||||||||||| |||    
44231462 aatcatgattggttttgggatccacttagggaaagcgggttacatgatttggtttacttgggctacgccactgtgcctcatgccctgccgatgactctat 44231561  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  | |||||||||||  | |||||||||||||||||||||||    
44231562 gcgagaggtggcatcccgagaccagcacttttcacatgcc-cttggggagatgactgtgactttggatgatgtcgcatgtct 44231642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 17566481 - 17566301
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||| | ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||| |||| ||  || ||||||| |||    
17566481 aatcagaattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcttcatcct--gctgatgactctat 17566384  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| |||| |||| || ||||||| ||||  |||||||||||||  | || |||||||||||||||||||||    
17566383 gcgagaggtggcatcccgacaccagcacttttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtctg 17566301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 47072491 - 47072319
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||| ||  |||||||||||  ||| ||||||| ||||||||||||    
47072491 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggctacgccaccgtgcctcatgccctgctgatgactctatgcgagaggt 47072392  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| ||||||||| ||   ||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
47072391 ggcatcccgagaccagcaccattcacatgcccttgggggagatgactgtgacattggatgatgtcgcatgtct 47072319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 50757848 - 50758021
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||||||| || |||| ||||||| ||||||||||||||| |   ||||||| || ||||||||||| ||||| ||||||| |||    
50757848 aatcatgattggttttggggtcctcttagggagagcgggttacatgatttggttttcctgggctacgccactgtgcctcatggtttgcagatgactctat 50757947  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| ||||||||| || || |||        |||||||||||||| | |||||||| ||||||||||||||    
50757948 gcgagaggtggcatcccgagaccagcacttctca--------tgggggagatgaccgtgactttggaggatgtcgcatgtct 50758021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 48890410 - 48890591
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| ||||||||||| |||| ||||||| ||||||||||||||| |   ||||||| || ||||||||||||||||  ||||||| |||    
48890410 aatcaagattggttttggggtccgcttagggagagcgggttacatgatttggttttcctgggctacgccactgtgcctcatgctttgttgatgactctat 48890509  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    || |||||| |||| || |||| | ||  |||  | ||||  ||| |||||||||| | |||||||| ||||||||||||||    
48890510 gcaagaggtggcatcccaagactagcacattttgcatgcccatggaggagatgaccgtgactttggaggatgtcgcatgtct 48890591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 49267679 - 49267498
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| ||||||   || ||| ||| |||||||||||||||||    |||||  || ||||||||||||  ||| ||||||| |||    
49267679 aatcaggattggttttgggatccgctttaggagagtgggttacatgatttggtttacctgtgctacaccattgtgcctcatgccctgctgatgactctat 49267580  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||| | |||| ||||||||| || ||||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
49267579 gcgagagatggcatcccgagaccagcacttttcacgtgcccttgggggagatgactgtgaccttggatgatgtcgcatgtct 49267498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 154
Target Start/End: Original strand, 42757867 - 42758018
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||| ||   ||||||| || ||||||||||||| ||| ||||||| |||    
42757867 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggttaacttgggctacgccactgtgcctcatgctctgctgatgactctat 42757966  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagat 154  Q
    ||||||||| ||||  ||||||   || ||||||| ||||  ||||||||||    
42757967 gcgagaggtggcatctcgagacagtcacttttcacatgcccttgggggagat 42758018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 36129215 - 36129387
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  ||| ||||||||||||||||||||    
36129215 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtacttcagcgtgcctcatgccctgctgatgactttatgcgagaggt 36129314  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||||||  |||||| ||||  |||||||||||||  | || |||||||||||||| |||||    
36129315 ggcatcctgagaccaacacctttcacatgcccatgggggagatgactgtgacattggatgatgtcgcttgtct 36129387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 126
Target Start/End: Original strand, 16612564 - 16612686
Alignment:
4 atcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatg 103  Q
    ||||||| ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   ||||||| ||  |||||||||||  ||| ||||||| ||||    
16612564 atcaggattggttttgggatccgcttaggcagagcgggttacatgacttggtttacttgggctacgccaccgtgcctcatgccctgctgatgactctatg 16612663  T
104 cgagaggttgcataccgagacca 126  Q
    |||||||| |||| |||||||||    
16612664 cgagaggtggcatcccgagacca 16612686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 22046689 - 22046567
Alignment:
4 atcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatg 103  Q
    ||||||| ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   ||||||| ||  |||||||||||  ||| ||||||| ||||    
22046689 atcaggattggttttgggatccgcttaggcagagcgggttacatgacttggtttacttgggctacgccaccgtgcctcatgccctgctgatgactctatg 22046590  T
104 cgagaggttgcataccgagacca 126  Q
    |||||||| |||| |||||||||    
22046589 cgagaggtggcatcccgagacca 22046567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 185
Target Start/End: Original strand, 46390704 - 46390854
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
46390704 gagcgggctacatgatttggtatacttggggtactccaccgtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 46390803  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||| ||||  |||||||||||||  | || |||||||||||||||||||||    
46390804 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtctg 46390854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 52389789 - 52389680
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  ||||||||||| |  | || ||||||||||    
52389789 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgtctgtgacattggatgatg 52389690  T
175 tcgcatgtct 184  Q
    ||||||||||    
52389689 tcgcatgtct 52389680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 2273379 - 2273207
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  ||||||||||||||||||| ||||    
2273379 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgccgatgactttatgcgaaaggt 2273280  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     ||||   ||||||| ||  |||||| || |  |||||||||||||  | || ||||||||||||||||||||    
2273279 ggcatcttgagaccagcacctttcacatgtccatgggggagatgactgtgacattggatgatgtcgcatgtct 2273207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 3977413 - 3977585
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  || ||||||||  ||| ||||||||||||||||||||    
3977413 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtactccaccgttcctcatgccctgctgatgactttatgcgagaggt 3977512  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  |||||||||||||  | || || |||||||||||||||||    
3977513 ggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattagatgatgtcgcatgtct 3977585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 4006717 - 4006545
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||  ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  ||| ||| ||||||||||| ||||    
4006717 tggttttgggatccgcttaggcagagcgggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgctgatcactttatgcgaaaggt 4006618  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
4006617 ggcatcctgagaccagcatctttcacatgcccatgggggagatgactgtgacattggatgatgtcgcatgtct 4006545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 598597 - 598778
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| || || |||| |||||| |||  ||||||| ||||||| ||||| |||   ||||||| || ||||||||||||  ||  ||||||| |||    
598597 aatcaggattgattttgggatccgcttaggcagagcgggttacatgacttggtctacctgggctacgccactgtgcctcatgccctgttgatgactctat 598696  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    |||| |||| |||| ||||||||| ||  |||||| || |  |||||||||||||  | || ||||||||||||||| |||||    
598697 gcga-aggtggcatcccgagaccagcacctttcacatgtccctgggggagatgactgtgacattggatgatgtcgcacgtctg 598778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 29010752 - 29010901
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  | |||||||||| ||| | | |||||||||||||||| |||| | ||||||| ||  ||     
29010752 gagcgggctacatgatttggtctacttggggtactccaccgcgcctcatgctctgctgcttactttatgcgagaggtggcatccggagaccagcaccttc 29010851  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| || |  |||||||||||||  | || ||||||||||||||||||||    
29010852 cacatgtcgatgggggagatgactgtgacattggatgatgtcgcatgtct 29010901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 34047218 - 34047327
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
34047218 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 34047317  T
175 tcgcatgtct 184  Q
    ||||||||||    
34047318 tcgcatgtct 34047327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 42902420 - 42902311
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
42902420 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 42902321  T
175 tcgcatgtct 184  Q
    ||||||||||    
42902320 tcgcatgtct 42902311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 54387918 - 54388027
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
54387918 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 54388017  T
175 tcgcatgtct 184  Q
    ||||||||||    
54388018 tcgcatgtct 54388027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 50479016 - 50478928
Alignment:
96 actttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
50479016 actttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 50478928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 49142778 - 49142669
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| |  |||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
49142778 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccgaagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 49142679  T
175 tcgcatgtct 184  Q
    ||||||||||    
49142678 tcgcatgtct 49142669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 42 - 184
Target Start/End: Original strand, 20425606 - 20425748
Alignment:
42 ctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgc 141  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||||| |||||||||||| ||||||| ||||||  |||| | ||  ||||||  ||    
20425606 ctacatgatttggtttacacgagctacgacattgtgcctcatgctttgctgatgactttatgtgagaggtagcatacgaagactagcagctttcacaagc 20425705  T
142 ctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    |  |||||||||||||| |||||||||||||||||||||||||    
20425706 ccttgggggagatgaccgttactttggatgatgtcgcatgtct 20425748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 42940670 - 42940472
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| | ||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||  || |||||||||||| |||  |||| || |||    
42940670 aatcaggattagttttgggatccgcttagggagagcgggttacatgacttggtttacttgggctacaccactgtgcctcatgccttgttgatg-ctctat 42940572  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaa 202  Q
    ||||||||| |||| ||||||||| || ||||||| ||||| |||||||||||||  | |||||||||||||||||||||||  || |||||| ||||||    
42940571 gcgagaggtggcatcccgagaccagcacttttcacatgcctttgggggagatgacagtgactttggatgatgtcgcatgtcttatgcatcttcagattaa 42940472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 185
Target Start/End: Original strand, 5198632 - 5198811
Alignment:
6 caggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcg 105  Q
    ||||| ||||| |||| ||| || |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||||  ||  ||||||| ||||||    
5198632 caggattggttttgggatccacttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgccctgttgatgactctatgcg 5198731  T
106 agaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    |||||| |||| ||||||||  || ||||||| ||||  |||||||||||||  | || ||| |||||||||||||||||    
5198732 agaggtggcatcccgagacctgcacttttcacatgcccttgggggagatgactgtgaccttgaatgatgtcgcatgtctg 5198811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 74 - 184
Target Start/End: Complemental strand, 8700649 - 8700539
Alignment:
74 tgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgat 173  Q
    ||||||||||||||||| ||||||| |||||||||||| |||| | ||||||| || ||||| | ||||  |||||||||||||||| |||||||| |||    
8700649 tgtgcctcatgctttgctgatgactctatgcgagaggtggcatcctgagaccagcacttttcccatgcccatgggggagatgaccatgactttggaggat 8700550  T
174 gtcgcatgtct 184  Q
    ||||| |||||    
8700549 gtcgcttgtct 8700539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 151
Target Start/End: Original strand, 38969794 - 38969942
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| ||| || |||| ||||||| |||||||||||||||||   |||||||  | |||||||||||||||||  |||||| |||    
38969794 aatcaggattggttttgggatccacttagggagagcgggttacatgatttggtttacctgggctacgctactgtgcctcatgctttgctaatgactctat 38969893  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtggggga 151  Q
    ||||||||| |||| | ||||||| || ||||||| ||||  |||||||    
38969894 gcgagaggtagcatcctgagaccagcacttttcacatgcccttggggga 38969942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 11 - 142
Target Start/End: Complemental strand, 40623368 - 40623237
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| |||||| |||| ||||||  |||||||||||||||||   ||||||| || ||||||||||||||||  ||||||| ||||||||||     
40623368 atggttttgggatccgcttagggagagcggattacatgatttggtttacctgggctacgccattgtgcctcatgctttgttgatgactctatgcgagaga 40623269  T
111 ttgcataccgagaccaacaattttcacttgcc 142  Q
    |  ||| |||||||||||| ||||||| ||||    
40623268 tgacatcccgagaccaacacttttcacatgcc 40623237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 7759082 - 7759255
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||    |||||| ||  |||||||||||  ||| ||||||| ||||||||||||    
7759082 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgagctacgccaccgtgcctcatgccctgctgatgactctatgcgagaggt 7759181  T
112 tgcataccgagaccaacaattttcacttgcctgtgggg-gagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| ||||||||| ||  |||||| ||||  ||||| ||||||||  | || ||||||||||||||||||||    
7759182 ggcatcccgagaccatcacctttcacatgcccttggggtgagatgactgtgacattggatgatgtcgcatgtct 7759255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 8578803 - 8578694
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||||||  |||||| ||||  |||||||||||||  | || ||||||||||    
8578803 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccaacacctttcacatgcccatgggggagatgactgtgacattggatgatg 8578704  T
175 tcgcatgtct 184  Q
    ||||||||||    
8578703 tcgcatgtct 8578694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 19039467 - 19039317
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
19039467 gagcgggctacatgatttggtatacttggggtactccaccgtgcctcatgcactgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 19039368  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||| ||||  |||||||||||||  | || |||||||||||||||||||||    
19039367 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtctg 19039317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 27671954 - 27671845
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  ||||||||||||   | || ||||||||||    
27671954 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgattgtgacattggatgatg 27671855  T
175 tcgcatgtct 184  Q
    ||||||||||    
27671854 tcgcatgtct 27671845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 28878378 - 28878527
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||||||||  ||| | ||||||||||||||||||  ||| | ||||||| ||  ||     
28878378 gagcgggctacatgatttggtttacttggggtactccaccgtgcctcatgccctgctgctgactttatgcgagaggtgacatccggagaccagcaccttc 28878477  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||| ||||||||||||||    
28878478 cacatgccgatgggggagatgactgtaacattggacgatgtcgcatgtct 28878527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 202
Target Start/End: Complemental strand, 42938824 - 42938743
Alignment:
121 agaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgattaa 202  Q
    |||||| || ||||||| ||||| |||||||||||||  | |||||||||||||||||||||||  || |||||| ||||||    
42938824 agaccagcacttttcacatgcctttgggggagatgacagtgactttggatgatgtcgcatgtcttatgcatcttcagattaa 42938743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 28240021 - 28239872
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  ||     
28240021 gagcgggctacatgatttggtctacttggggtactccaccgtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttc 28239922  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || |||||||| |||||||||||    
28239921 cacatgccgatgggggagatgactgtgacattggatgaagtcgcatgtct 28239872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 7252189 - 7252262
Alignment:
102 tgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgt 175  Q
    |||||||||| ||| || |||||||| | ||||||  | ||||||||||||||||| || |||||||| |||||    
7252189 tgcgagaggtggcacacggagaccaatagttttcatctacctgtgggggagatgacgatcactttggacgatgt 7252262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 23066399 - 23066472
Alignment:
102 tgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgt 175  Q
    |||||||||| ||| || |||||||| | ||||||  | ||||||||||||||||| || |||||||| |||||    
23066399 tgcgagaggtggcacacggagaccaatagttttcatctacctgtgggggagatgacgatcactttggacgatgt 23066472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 23)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 27452000 - 27451818
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| | |||| |||| ||||||| |||||||||||||||||   || |||  || ||||||||||||  ||| ||||||| |||    
27452000 aatcaggattggttttgggattcgcttagggagagcgggttacatgatttggtttacctgggatacaccactgtgcctcatgccctgctgatgactctat 27451901  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| |||||||||||| ||||||| ||||  |||||||||||||  | || |||||||||||||||||||||    
27451900 gcgagaggtggcatcccgagaccaacacttttcacatgcccttgggggagatgactgtgacattggatgatgtcgcatgtctg 27451818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 9493162 - 9492989
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| |||||| |||| ||||||| ||||||||||||||| |   ||||||  || ||||||||||||||||| ||||||| |||||||||||    
9493162 atggttttgggatccgcttagggagagcgggttacatgatttggttttcttgggctaccccactgtgcctcatgctttgctgatgactctatgcgagagg 9493063  T
111 ttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | |||| ||||||||| || ||||||| ||||  || ||||||||||| | |||||||| ||||||| ||||||    
9493062 tggcatcccgagaccagcacttttcacatgcccatgagggagatgaccgtgactttggaggatgtcgtatgtct 9492989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 180
Target Start/End: Original strand, 37341990 - 37342166
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||  |||||||||||||||||   ||||||| || ||||||||||||||||  ||||||| |||    
37341990 aatcaggattggttttgggatccgcttagggagagcggattacatgatttggtttacctgggctacgccactgtgcctcatgctttgatgatgactctat 37342089  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcat 180  Q
    ||||||||| |||| |||||||| | | ||||||| ||||  ||||| |||||||  | |||||||||||||||||||    
37342090 gcgagaggtggcatcccgagacc-agacttttcacatgcccttggggaagatgactgtgactttggatgatgtcgcat 37342166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 39462119 - 39462300
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||  |||||||||||||||||    |||||| || ||||||||||||  ||| ||||||| |||    
39462119 aatcaagattggttttgggatccgcttagggagagcggattacatgatttggtttacctgtgctacgccactgtgcctcatgccctgctgatgactctat 39462218  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
39462219 gcgagaggtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtct 39462300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 36979281 - 36979462
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| | ||||||||| |||| ||||||| ||||||||||| ||| |  |||||||| || ||||||||||| |||||  |||||| |||    
36979281 aatcaggattggtttttgggtccgcttagggagagcgggttacatgatttgattttcctaggctacgccattgtgcctcatgttttgctaatgactctat 36979380  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    |||||||||  ||| |  |||||| || || |||| ||||  |||||||||||||| | |||||||| ||||||||||||||    
36979381 gcgagaggtgacatcctaagaccagcacttctcacatgcccatgggggagatgaccgtgactttggaggatgtcgcatgtct 36979462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 5539625 - 5539444
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||| ||||||| || ||||||   ||||| | || ||||||||||||  ||| ||||||| |||    
5539625 aatcatgattggttttgggatccgcttagggagagcgggttacatgactttgtttacctgggctatgccactgtgcctcatgccctgctgatgactctat 5539526  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||||| || | ||||||||||||  |||||| ||||  |||||||||||||  | || ||||||||||||||||||||    
5539525 gcgagaggtggcttcccgagaccaacatctttcacatgcccttgggggagatgactgtgaccttggatgatgtcgcatgtct 5539444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 11636399 - 11636580
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| |||||   ||||||| ||||||||    ||||||| || ||||||||||||   || |||||||||||    
11636399 aatcaagattggttttgggatccgcttagggagagcgaattacatgagttggtttatctgggctacgccactgtgcctcatgcccggctgatgactttat 11636498  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    |||||| || |||| ||||||||| || ||||||| ||||  |||||||||||||  | |||||||||||||||||||||||    
11636499 gcgagatgtggcatcccgagaccagcacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtct 11636580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 34740480 - 34740662
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    ||||| || ||||| |||| |||||| |||| ||||||| ||||||| |||| ||||   ||||||| || ||||||||||||  ||| |||||||  ||    
34740480 aatcatgattggttttgggatccgcttagggagagcgggttacatgacttggattacctgggctacgccactgtgcctcatgccctgctgatgactccat 34740579  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| ||||||||| ||  |||||| |||   ||||||||||||   | || |||||||||||||||||||||    
34740580 gcgagaggtggcatcccgagaccagcacctttcacatgctcttgggggagatgattgtgaccttggatgatgtcgcatgtctg 34740662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 15072575 - 15072426
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||  ||| |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
15072575 gagcgggctacatgatttggtttacttagggtactccaccgtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 15072476  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
15072475 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 15072426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 47671496 - 47671328
Alignment:
11 atggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagagg 110  Q
    |||||| |||| || ||| |||| ||| ||| ||||||||||||||| |   ||||||  || |||| |||||||||||| |||||||     |||||||    
47671496 atggttttgggatctgcttagggagagagggttacatgatttggttttcttgggctaccccactgtgtctcatgctttgctgatgact-----cgagagg 47671402  T
111 ttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | |||| |||||||||||| ||||||| ||||  |||||||||||| | | |||||||| ||||||||||||||    
47671401 tggcatcccgagaccaacacttttcacatgcccatgggggagatgatcgtgactttggaggatgtcgcatgtct 47671328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 184
Target Start/End: Complemental strand, 11633410 - 11633318
Alignment:
92 gatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||||| |||||||||||| ||||  ||||||||||| ||||||| ||||  |||||||||||||  | |||||||||||||||||||||||    
11633410 gatgactctatgcgagaggtagcatctcgagaccaacacttttcacatgcccttgggggagatgactgtgactttggatgatgtcgcatgtct 11633318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 42506236 - 42506087
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||||||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
42506236 gagcgggctacatgatttggtttacttggggtactccaccgtgcctcatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 42506137  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
42506136 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 42506087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 185
Target Start/End: Original strand, 19801209 - 19801316
Alignment:
78 cctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcg 177  Q
    ||||||||  ||| ||||||| |||||||||||| |||| ||||||||| || ||||||| | ||  |||||||||||||  | || |||||||||||||    
19801209 cctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacttttcacatacccttgggggagatgactgtgaccttggatgatgtcg 19801308  T
178 catgtctg 185  Q
    ||||||||    
19801309 catgtctg 19801316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 17836762 - 17836871
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  |||||||||||||  | || ||||||||||    
17836762 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatgggggagatgactgtgacattggatgatg 17836861  T
175 tcgcatgtct 184  Q
    || |||||||    
17836862 tcacatgtct 17836871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 17461566 - 17461417
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  ||     
17461566 gagcgggctacatgatttggtctacttggggtactccaccgtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttc 17461467  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
17461466 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 17461417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 17591648 - 17591797
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  ||     
17591648 gagcgggctacatgatttggtctacttggggtactccaccgtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttc 17591747  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
17591748 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 17591797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 185
Target Start/End: Original strand, 16679286 - 16679399
Alignment:
71 caatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggat 170  Q
    |||||||||||||||  ||| ||||||| ||||||||||||  ||| ||||||||| || ||||||| || |  | ||||||||||   | || ||||||    
16679286 caatgtgcctcatgccctgctgatgactctatgcgagaggtgccatcccgagaccatcacttttcacatgtc-cttggggagatgaatgtgaccttggat 16679384  T
171 gatgtcgcatgtctg 185  Q
    |||||||||||||||    
16679385 gatgtcgcatgtctg 16679399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 185
Target Start/End: Original strand, 17653522 - 17653635
Alignment:
71 caatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggat 170  Q
    |||||||||||||||  ||| ||||||| ||||||||||||  ||| ||||||||| || ||||||| || |  | ||||||||||   | || ||||||    
17653522 caatgtgcctcatgccctgctgatgactctatgcgagaggtgccatcccgagaccatcacttttcacatgtc-cttggggagatgaatgtgaccttggat 17653620  T
171 gatgtcgcatgtctg 185  Q
    |||||||||||||||    
17653621 gatgtcgcatgtctg 17653635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 9369666 - 9369557
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
9369666 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 9369567  T
175 tcgcatgtct 184  Q
    ||||||||||    
9369566 tcgcatgtct 9369557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 35608655 - 35608546
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
35608655 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 35608556  T
175 tcgcatgtct 184  Q
    ||||||||||    
35608555 tcgcatgtct 35608546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 41882333 - 41882442
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
41882333 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 41882432  T
175 tcgcatgtct 184  Q
    ||||||||||    
41882433 tcgcatgtct 41882442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 48405151 - 48405260
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
48405151 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 48405250  T
175 tcgcatgtct 184  Q
    ||||||||||    
48405251 tcgcatgtct 48405260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 13319084 - 13319149
Alignment:
92 gatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgac 157  Q
    ||||||| |||||||||||| |||| ||||||||| ||  |||||| ||||  |||||||||||||    
13319084 gatgactctatgcgagaggtggcatcccgagaccagcacctttcacatgcccttgggggagatgac 13319149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 3 - 185
Target Start/End: Complemental strand, 36654805 - 36654623
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||||| |||||||||||||||||   ||||||| || ||||||||||||  ||| ||||||| |||    
36654805 aatcaggattggttttgggatccgcttagggagagcgggttacatgatttggtttacctgggctacgccactgtgcctcatgccctgctgatgactctat 36654706  T
103 gcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||||||||| |||| ||||||||| || ||||||| ||||  || || |||||||  | || |||||||||||||||||||||    
36654705 gcgagaggtggcatcccgagaccagcacttttcacatgcccttgcggaagatgactgtgaccttggatgatgtcgcatgtctg 36654623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 38 - 200
Target Start/End: Complemental strand, 29399908 - 29399746
Alignment:
38 cgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcac 137  Q
    |||| ||||||| |||||||||  |||||||| ||  |||||||||||  ||| ||||||| |||||||||||| |||| ||||||||| ||  ||||||    
29399908 cgggttacatgacttggtttacctaggctacgccaccgtgcctcatgccctgctgatgactctatgcgagaggtggcatcccgagaccagcacctttcac 29399809  T
138 ttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctgttgtatcttctgatt 200  Q
     || |  |||||||||||||  | || ||||||||| ||||||||||| || |||||| ||||    
29399808 atgtccttgggggagatgactgtgacattggatgatttcgcatgtctgatgcatcttccgatt 29399746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 28470290 - 28470439
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||||||||  ||| |||||||||||||||||||| ||||   ||||||| ||  |||    
28470290 gagcgggctacatgatttggtttactttgggtactccaccgtgcctcatgccctgctgatgactttatgcgagaggtggcatcatgagaccagcaccttt 28470389  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
28470390 cacatgcccatgggggagatgactgtgacattggatgatgtcgcatgtct 28470439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 45 - 184
Target Start/End: Original strand, 40537321 - 40537459
Alignment:
45 catgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctg 144  Q
    ||||||||||||| |   ||||||  || |||||||||||| |||| ||||||| ||||| |||||| |||| | |||||||||||||||||| ||||      
40537321 catgatttggttttcttgggctacaccactgtgcctcatgcattgctgatgactctatgcaagaggtggcatccagagaccaacaattttcacatgcc-c 40537419  T
145 tgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     ||||||||||||  | |||||||| ||||||||||||||    
40537420 agggggagatgactgtgactttggaggatgtcgcatgtct 40537459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 7188568 - 7188734
Alignment:
18 tggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcata 117  Q
    |||| |||||| |||| ||||||| ||||||| |||||||||   || |||  ||  |||||||||||  |||  || ||||||||||| |||| ||||     
7188568 tgggatccgcttagggagagcgggttacatgacttggtttacttggggtactccaccgtgcctcatgccctgctaataactttatgcgaaaggtggcatc 7188667  T
118 ccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    | ||||||||||| |||||| ||||  | |||||||||||  | || ||||||||||||||||||||    
7188668 ctgagaccaacaactttcacatgcccataggggagatgactgtgacattggatgatgtcgcatgtct 7188734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 185
Target Start/End: Original strand, 17422237 - 17422387
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    |||||||||||||||||||||||||   || |||  ||  |||||| ||||  ||| | |||||||||||||||||| |||| | ||||||| ||  ||     
17422237 gagcgggctacatgatttggtttacttggggtactccaccgtgccttatgccctgctgctgactttatgcgagaggtggcatccggagaccagcaccttc 17422336  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtctg 185  Q
    ||| ||||  |||||||||||||  | || |||||||||||||||||||||    
17422337 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtctg 17422387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 22679324 - 22679433
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| |||   |||||||||||||  | || ||||||||||    
22679324 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgctcatgggggagatgactgtgacattggatgatg 22679423  T
175 tcgcatgtct 184  Q
    ||||||||||    
22679424 tcgcatgtct 22679433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 39949283 - 39949392
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| |||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  ||| |||||||||  | || ||||||||||    
39949283 gtgcctcatgccctgctgatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccatggaggagatgactgtgacattggatgatg 39949382  T
175 tcgcatgtct 184  Q
    ||||||||||    
39949383 tcgcatgtct 39949392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 184
Target Start/End: Original strand, 45430497 - 45430642
Alignment:
39 gggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcact 138  Q
    |||||||||||||||||||||   || |||  ||  |||||||||||  ||  |||||||||||||||||||| |||| | ||||||| ||  || |||     
45430497 gggctacatgatttggtttacttggggtactccaccgtgcctcatgccctgttgatgactttatgcgagaggtggcatccggagaccagcaccttccaca 45430596  T
139 tgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||||  |||||||||||||  | || ||||||||||||||||||||    
45430597 tgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 45430642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 10827223 - 10827052
Alignment:
12 tggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggt 111  Q
    ||||| |||| |||||| |||| ||||||| ||||||| |||||||||   ||||||  ||  |||||||||||  ||| ||| ||| ||||||||||||    
10827223 tggttttgggatccgcttagggagagcgggttacatgacttggtttacctgggctacaccaccgtgcctcatgccctgctgataactctatgcgagaggt 10827124  T
112 tgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
     |||| | ||||||| ||  |||||| ||||  ||||| |||||||  | || ||||||||||||||||||||    
10827123 ggcatcctgagaccagcacctttcacatgcccttgggg-agatgactgtgacattggatgatgtcgcatgtct 10827052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 43980314 - 43980423
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||||||  || ||| ||||  |||||||||||||  | || ||||||||||    
43980314 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccaacaccttccacatgccgatgggggagatgactgtgacattggatgatg 43980413  T
175 tcgcatgtct 184  Q
    ||||||||||    
43980414 tcgcatgtct 43980423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 3939018 - 3938909
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
3939018 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 3938919  T
175 tcgcatgtct 184  Q
    ||||||||||    
3938918 tcgcatgtct 3938909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 5353800 - 5353909
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
5353800 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtaacattggatgatg 5353899  T
175 tcgcatgtct 184  Q
    ||||||||||    
5353900 tcgcatgtct 5353909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 184
Target Start/End: Original strand, 15833009 - 15833158
Alignment:
35 gagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaatttt 134  Q
    ||||||||||||||||||||| |||   || |||  ||  |||||||||||  ||| | | |||||||||||||||| | || | ||||||| ||  ||     
15833009 gagcgggctacatgatttggtctacttggggtactccaccgtgcctcatgccctgctgcttactttatgcgagaggtggtatccggagaccagcaccttc 15833108  T
135 cacttgcctgtgggggagatgaccattactttggatgatgtcgcatgtct 184  Q
    ||| ||||  |||||||||||||  | || ||||||||||||||||||||    
15833109 cacatgccgatgggggagatgactgtgacattggatgatgtcgcatgtct 15833158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 30495225 - 30495116
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| ||||  |||||||||||||  | || ||||||||||    
30495225 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgccgatgggggagatgactgtgacattggatgatg 30495126  T
175 tcgcatgtct 184  Q
    ||||||||||    
30495125 tcgcatgtct 30495116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 43537968 - 43537859
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  ||| | | |||||||||||||||| |||| | ||||||| ||  || ||| |||   |||||||||||||  | || ||||||||||    
43537968 gtgcctcatgccctgctgcttactttatgcgagaggtggcatccggagaccagcaccttccacatgctgatgggggagatgactgtgacattggatgatg 43537869  T
175 tcgcatgtct 184  Q
    ||||||||||    
43537868 tcgcatgtct 43537859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0238 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0238
Description:

Target: scaffold0238; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 3 - 122
Target Start/End: Complemental strand, 17356 - 17237
Alignment:
3 aatcaggaatggttctggggtccgctgagggcgagcgggctacatgatttggtttacacaggctacgacaatgtgcctcatgctttgccgatgactttat 102  Q
    |||||||| ||||| |||| |||||| |||| ||||| | |||||||||||||||||  |||||||| || ||||||||||||| ||| ||||||| |||    
17356 aatcaggattggttttgggatccgctaagggagagcgagttacatgatttggtttacctaggctacgccactgtgcctcatgctctgctgatgactctat 17257  T
103 gcgagaggttgcataccgag 122  Q
    ||||||||| |||| |||||    
17256 gcgagaggtggcatcccgag 17237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 200
Target Start/End: Complemental strand, 14192 - 14067
Alignment:
75 gtgcctcatgctttgccgatgactttatgcgagaggttgcataccgagaccaacaattttcacttgcctgtgggggagatgaccattactttggatgatg 174  Q
    |||||||||||  |||  ||||||||||||||||||| |||| | ||||||| ||  |||||| ||||  | |||||||||||  | || ||||||||||    
14192 gtgcctcatgccctgcttatgactttatgcgagaggtggcatcctgagaccagcacctttcacatgcccataggggagatgactgtgacattggatgatg 14093  T
175 tcgcatgtctgttgtatcttctgatt 200  Q
    ||||||||||   | |||||||||||    
14092 tcgcatgtctcacgcatcttctgatt 14067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University