View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_143 (Length: 237)
Name: NF18178_low_143
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_143 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 30885964 - 30885737
Alignment:
| Q |
17 |
cttccaagagattaacggaaacaaaaatgaagtctaaaagcacgcttatagaaggaatgaatgagattcaaaaggatctcaggtcataattaattttgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885964 |
cttccaagagattaacggaaacaaaaatgaagtctaaaagcacgcttatagaaggaatgaatgagattcaaaaggatctcaggtcataattaattttgaa |
30885865 |
T |
|
| Q |
117 |
tgtaaatatagatattaattattaa-------tgaaaaatgaaggctgcattatactatcaaatcaaacccctgcagtatcatcagaaacattgtacaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885864 |
tgtaaatatagatattaattattaatgaataatgaaaaatgaaggttgcattatactatcaaatcaaacccctgcagtatcatcagaaacattgtacaaa |
30885765 |
T |
|
| Q |
210 |
caataacatgcaatagcacgcacctccc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30885764 |
caataacatgcaatagcacgcacctccc |
30885737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University