View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_144 (Length: 237)
Name: NF18178_low_144
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_144 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 143 - 219
Target Start/End: Original strand, 49755076 - 49755152
Alignment:
| Q |
143 |
aaacatgacatgagaatgtggcgatagcatgtattactcctcccttggctctcgtgtgattcgttaaatgagaatta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755076 |
aaacatgacatgagaatgtggcgatagcatgtattactcctcccttggctctcgtgtgattcgttaaatgagaatta |
49755152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 55 - 114
Target Start/End: Original strand, 49754939 - 49754998
Alignment:
| Q |
55 |
taccgaattcatccctattggtcaacacataccaaactgtttctattgcaagaagcatat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49754939 |
taccgaattcatccctattggtcaacacatgccaaactgtttctattgcaagaagcatat |
49754998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University