View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_154 (Length: 227)
Name: NF18178_low_154
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_154 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 136 - 227
Target Start/End: Original strand, 31606901 - 31606992
Alignment:
| Q |
136 |
attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31606901 |
attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacat |
31606992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 31606826 - 31606867
Alignment:
| Q |
1 |
atggtttatttcaaaactttacaaattcaagtaaaattttgc |
42 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31606826 |
atggtttatttcaaaactttacaagctcaagtaaaattttgc |
31606867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University