View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_155 (Length: 227)
Name: NF18178_low_155
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_155 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 2484450 - 2484256
Alignment:
| Q |
16 |
tattcaaattcgtaatgcatccatgtcttgaatgttgcggaatgggaagactttggaggaattcatcatgctcatggcattctgcaaggatatcacatca |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484450 |
tattcaaattcgaaatgcatccatgtcttgaatgttgtggaatgggaagactttggaggaattcatcatgctcatggcattctgcaaggatatcacatca |
2484351 |
T |
 |
| Q |
116 |
catattttcttatatttttgtctctttttcacttgtttaacctagctgttgaccaatatatattaggtcatggttgcttgcacatggagtcccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484350 |
catattttcttatatttttgtctctttttcacttgtttaacctagctgttgaccaatatatattaggtcatggttgcttgcacatggagtcccta |
2484256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University