View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_36 (Length: 468)
Name: NF18178_low_36
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 1e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 198 - 416
Target Start/End: Original strand, 32141252 - 32141495
Alignment:
| Q |
198 |
aatcagtctatagaagatcatcaacttaatgtcctgaaaccaattatgatctccaattgtttcactttttgtagttgcattgtcaaaagatttgttggca |
297 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32141252 |
aatcagtccatagaagatcatcaacttaatgtcctgaaacaaattatgatctccaattgtttcactttttgtagttgcattgtcaaaagatttgttggca |
32141351 |
T |
|
| Q |
298 |
acattaacggtgtttggtgccacgtagttgttgttagtatgtggaacagggtcattgta------------------accatggtgataagga------- |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32141352 |
acattaacggtgtttggtgccacgtagttgttgttagtatgtggaacagggtcattgtacatacaattgtaatcgtaaccatggtgataaggataagtaa |
32141451 |
T |
|
| Q |
373 |
caccagaatcatcagcacaaatatgagttgaaccagaatgattt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32141452 |
caccagaatcatcagcacaaatatgagttgaaccagaatgattt |
32141495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 13 - 150
Target Start/End: Original strand, 32141071 - 32141204
Alignment:
| Q |
13 |
tgagatgaaatacaaatgctatgatttgtagatagcttattgagctaacaacagataactaactaactaattatttatagacatgcaaattaatcctcca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
32141071 |
tgagatgaaatacaaatgctatgatttgtagatagcttattgagctaacaacagataactaactaac----tatttatagacatgcaaattagtcctcca |
32141166 |
T |
|
| Q |
113 |
ccatttgcaattttggcaaggctatacaatcacctgtt |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32141167 |
ccatatgcaattttggcaaggctatacaatcacctgtt |
32141204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University