View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_74 (Length: 363)
Name: NF18178_low_74
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 38918971 - 38918709
Alignment:
| Q |
19 |
gaagaggacgatagggttataaaccataggtgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaaggtttgatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918971 |
gaagaggacgatagggttataaaccataggcgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaaggtttgatg |
38918872 |
T |
|
| Q |
119 |
atttctttggagattatttcaacttctaacttcattcttaaa---tatatcttattgatgtttatggaacagcttcaatgtttattgtgttgtgttatcg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918871 |
atttctttggagattatttcaacttctaacttcattcttaaatagtatatcttattgatgtttatggaacagcttcaatgtttattgtgttgtgttatcg |
38918772 |
T |
|
| Q |
216 |
tctcgtcttttgtctctctatca----tgttccatatgtatatatagtgatatcaattccttc |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918771 |
tctcgtcttttgtctctctatcatgtttgttccatatgtatatatagtgatatcaattccttc |
38918709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 309 - 348
Target Start/End: Complemental strand, 38918679 - 38918640
Alignment:
| Q |
309 |
aaaattgaaatcaattcctaaattcgaggtttcttgtaag |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918679 |
aaaattgaaatcaattcctaaattcgaggtttcttgtaag |
38918640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University