View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_75 (Length: 361)
Name: NF18178_low_75
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 218
Target Start/End: Original strand, 36534355 - 36534564
Alignment:
| Q |
11 |
gcagcacagatatattatgcgaattcgtttgtttgcactttgcagccattgttgagagctacttcttcctttccattgcgtcccctctccactatgtgat |
110 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534355 |
gcagcacacatatattacgcgaattcgtttgtttgcactttgcagccattgttgagagctacttcttcctttccattgcgtcccctctccactatgtgat |
36534454 |
T |
 |
| Q |
111 |
tgcatataattctccccagcactgctatatggcacgacatgccattcgttgaatctgcacgagcgcttaattttagtcacttgcttggcttataaa--tt |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36534455 |
tgcatataattctcaccagcactgctatatggcacgacatgccattcgttgaatctgcacgagcgcttaattttagtcacttgcttggcttataaatttt |
36534554 |
T |
 |
| Q |
209 |
cacttttcat |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
36534555 |
cacttttcat |
36534564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 234
Target Start/End: Original strand, 36534582 - 36534612
Alignment:
| Q |
204 |
aaattcacttttcatcatgattgttttggtc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36534582 |
aaattcacttttcatcatgattgttttggtc |
36534612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University