View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_76 (Length: 360)
Name: NF18178_low_76
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 4793274 - 4793074
Alignment:
| Q |
11 |
caaaggaaatgatagaaattaaaggaagtgaaaatgttaaagagcgattggattttgcattcatttaaagtaataannnnnnncttaattaaatcgcagg |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
4793274 |
caaaggaaatgatag-----aaaggaagtgaaaatgttaaagagcgattggattttgcattcaattaaagtaataatttttttcttaattaaatcgcagg |
4793180 |
T |
 |
| Q |
111 |
ttttctctattcaccggtgccgatctcggcaatgccgcccgtggttgcattcacatttgttttcatgtattattacatgcttcctatggtatatagttgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4793179 |
ttttctctattcaccggtgccgatctcggcaatgccgcccgtggttgcattcacattagttttcatg---tattacatgcttcctatggtatatagttgg |
4793083 |
T |
 |
| Q |
211 |
accacgagg |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
4793082 |
accacgagg |
4793074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 217 - 309
Target Start/End: Complemental strand, 4793023 - 4792931
Alignment:
| Q |
217 |
aggaggggcgttgatctttggctatttctacatagcactcatgttgactgcaattcatttcccagtgaaattcaaacactaggaaattatttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4793023 |
aggaggggcgttgatctttggctatttctacatagcactcatgttgactgcaattcatttcctagtgaaattcaaacactaggaaatgatttg |
4792931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University